HMG20B cdna clone
HMG20B cDNA Clone
Gene Names
HMG20B; SOXL; HMGX2; BRAF25; BRAF35; HMGXB2; PP7706; pp8857; SMARCE1r
Synonyms
HMG20B; HMG20B cDNA Clone; HMG20B cdna clone
Sequence
atgtcccacggccccaagcagcccggcgcggccgccgcgccggcgggcggcaaggctccgggccagcatgggggcttcgtggtgactgtcaagcaagagcgcggcgagggtccacgcgcgggcgagaaggggtcccacgaggaggagccggtgaagaaacgcggctggcccaagggcaagaagcggaagaagattctgccgaatgggcccaaggcaccggtcacgggctacgtgcgcttcctgaacgagcggcgcgagcagatccgcacgcgccacccggatctgccctttcccgagatcaccaagatgctgggcgccgagtggagcaagctgcagccaacggaaaagcagcggtacctggatgaggccgagagagagaagcagcagtacatgaaggagctgcgggcgtaccagcagtctgaagcctataagatgtgcacggagaagatccaggagaagaagatcaagaaagaagactcgagctctgggctcatgaacactctcctgaatggacacaagggtggggactgcgatggcttctccaccttcgatgttcccatcttcactgaagagttcttggaccaaaacaaagcgcgtgaggcggagcttcggcgcttgcggaagatgaatgtggccttcgaggagcagaacgcggtactgcagaggcacacgcagagcatgagcagcgcgcgcgagcgtctggagcaggagctggcgctggaggagcggaggacgctggcgctgcagcagcagctccaggccgtgcgccaggcgctcaccgccagcttcgcctcactgccggtgccgggcacgggcgaaacgcccacgctgggcactctggacttctacatggcccggcttcacggagccatcgagcgcgaccccgcccagcacgagaagctcatcgtccgcatcaaggaaatcctggcccaggtcgccagcgagcacctgtga
Sequence Length
954
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
32,939 Da
NCBI Official Full Name
Homo sapiens high-mobility group 20B, mRNA
NCBI Official Synonym Full Names
high mobility group 20B
NCBI Official Symbol
HMG20B
NCBI Official Synonym Symbols
SOXL; HMGX2; BRAF25; BRAF35; HMGXB2; PP7706; pp8857; SMARCE1r
NCBI Protein Information
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1-related
UniProt Protein Name
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1-related
UniProt Gene Name
HMG20B
UniProt Synonym Gene Names
BRAF35; HMGX2; HMGXB2; SMARCE1R; SMARCE1-related protein
UniProt Entry Name
HM20B_HUMAN
Uniprot Description
HMG20B: Required for correct progression through G2 phase of the cell cycle and entry into mitosis. Required for RCOR1/CoREST mediated repression of neuronal specific gene promoters. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: DNA-binding; Transcription factor
Chromosomal Location of Human Ortholog: 19p13.3
Cellular Component: nucleoplasm
Molecular Function: histone deacetylase activity; protein binding
Biological Process: blood coagulation
Research Articles on HMG20B
Similar Products
Product Notes
The HMG20B hmg20b (Catalog #AAA1273331) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcccacg gccccaagca gcccggcgcg gccgccgcgc cggcgggcgg caaggctccg ggccagcatg ggggcttcgt ggtgactgtc aagcaagagc gcggcgaggg tccacgcgcg ggcgagaagg ggtcccacga ggaggagccg gtgaagaaac gcggctggcc caagggcaag aagcggaaga agattctgcc gaatgggccc aaggcaccgg tcacgggcta cgtgcgcttc ctgaacgagc ggcgcgagca gatccgcacg cgccacccgg atctgccctt tcccgagatc accaagatgc tgggcgccga gtggagcaag ctgcagccaa cggaaaagca gcggtacctg gatgaggccg agagagagaa gcagcagtac atgaaggagc tgcgggcgta ccagcagtct gaagcctata agatgtgcac ggagaagatc caggagaaga agatcaagaa agaagactcg agctctgggc tcatgaacac tctcctgaat ggacacaagg gtggggactg cgatggcttc tccaccttcg atgttcccat cttcactgaa gagttcttgg accaaaacaa agcgcgtgag gcggagcttc ggcgcttgcg gaagatgaat gtggccttcg aggagcagaa cgcggtactg cagaggcaca cgcagagcat gagcagcgcg cgcgagcgtc tggagcagga gctggcgctg gaggagcgga ggacgctggc gctgcagcag cagctccagg ccgtgcgcca ggcgctcacc gccagcttcg cctcactgcc ggtgccgggc acgggcgaaa cgcccacgct gggcactctg gacttctaca tggcccggct tcacggagcc atcgagcgcg accccgccca gcacgagaag ctcatcgtcc gcatcaagga aatcctggcc caggtcgcca gcgagcacct gtga. It is sometimes possible for the material contained within the vial of "HMG20B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
