Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

Map

HLA-DQB2 cdna clone

HLA-DQB2 cDNA Clone

Gene Names
HLA-DQB2; HLA-DXB; HLA-DQB1
Synonyms
HLA-DQB2; HLA-DQB2 cDNA Clone; HLA-DQB2 cdna clone
Ordering
For Research Use Only!
Sequence
ATGTCTTGGAAGATGGCTCTGCAGATCCCTGGAGGCTTTTGGGCAGCAGCTGTGACCGTGATGCTGGTGATGCTGAGCACCCCAGTGGCTGAGGCCAGAGACTTTCCCAAGGATTTCTTGGTCCAGTTTAAGGGCATGTGCTACTTCACCAACGGGACAGAGCGCGTGCGGGGTGTGGCCAGATACATCTATAACCGCGAGGAGTACGGGCGCTTCGACAGCGACGTTGGGGAGTTCCAGGCGGTGACCGAGCTGGGGCGGAGCATCGAGGACTGGAACAACTATAAGGACTTCTTGGAGCAGGAGCGGGCCGCGGTGGACAAGGTGTGCAGACACAACTACGAGGCGGAGCTACGCACGACCTTGCAGCGGCAAGTGGAGCCCACAGTGACCATCTCCCCATCCAGGACAGAGGCCCTCAACCACCACAACCTGCTGGTCTGCTCAGTGACAGATTTCTATCCAGCCCAGATCAAAGTCCAGTGGTTTCGGAATGACCAGGAGGAGACAGCCGGTGTTGTGTCCACCTCCCTCATTAGGAATGGTGACTGGACCTTCCAGATTCTGGTGATGCTGGAAATAACTCCCCAGCGTGGAGACATCTACACCTGCCAAGTGGAGCACCCCAGCCTCCAGAGCCCCATCACCGTGGAGTGGCGACCTCGAGGGCCTCCACCTGCAGGACTCCTGCACTGA
cDNA Size
696 bp
Definition
Homo sapiens major histocompatibility complex, class II, DQ beta 2,mRNA (cDNA clone IMAGE: 4747201).
Recombination site
attL1, attL2
Vector
pENTR223.1 (spectinomycin)

Map

Map

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
NCBI Official Full Name
Homo sapiens major histocompatibility complex, class II, DQ beta 2, mRNA
NCBI Official Synonym Full Names
major histocompatibility complex, class II, DQ beta 2
NCBI Official Symbol
HLA-DQB2
NCBI Official Synonym Symbols
HLA-DXB; HLA-DQB1
NCBI Protein Information
HLA class II histocompatibility antigen, DQ beta 2 chain
UniProt Protein Name
HLA class II histocompatibility antigen, DQ beta 2 chain
UniProt Gene Name
HLA-DQB2
UniProt Synonym Gene Names
HLA-DXB
UniProt Entry Name
DQB2_HUMAN

NCBI Description

HLA-DQB2 belongs to the family of HLA class II beta chain paralogs. Class II molecules are heterodimers consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. They play a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). Polymorphisms in the alpha and beta chains specify the peptide binding specificity, and typing for these polymorphisms is routinely done for bone marrow transplantation. However this gene, HLA-DQB2, is not routinely typed, as it is not thought to have an effect on transplantation. There is conflicting evidence in the literature and public sequence databases for the protein-coding capacity of HLA-DQB2. Because there is evidence of transcription and an intact ORF, HLA-DQB2 is represented in Entrez Gene and in RefSeq as a protein-coding locus. [provided by RefSeq, Oct 2010]

Uniprot Description

HLA-DQB2: Binds peptides derived from antigens that access the endocytic route of antigen presenting cells (APC) and presents them on the cell surface for recognition by the CD4 T-cells. The peptide binding cleft accommodates peptides of 10-30 residues. The peptides presented by MHC class II molecules are generated mostly by degradation of proteins that access the endocytic route, where they are processed by lysosomal proteases and other hydrolases. Exogenous antigens that have been endocytosed by the APC are thus readily available for presentation via MHC II molecules, and for this reason this antigen presentation pathway is usually referred to as exogenous. As membrane proteins on their way to degradation in lysosomes as part of their normal turn-over are also contained in the endosomal/lysosomal compartments, exogenous antigens must compete with those derived from endogenous components. Autophagy is also a source of endogenous peptides, autophagosomes constitutively fuse with MHC class II loading compartments. In addition to APCs, other cells of the gastrointestinal tract, such as epithelial cells, express MHC class II molecules and CD74 and act as APCs, which is an unusual trait of the GI tract. To produce a MHC class II molecule that presents an antigen, three MHC class II molecules (heterodimers of an alpha and a beta chain) associate with a CD74 trimer in the ER to form a heterononamer. Soon after the entry of this complex into the endosomal/lysosomal system where antigen processing occurs, CD74 undergoes a sequential degradation by various proteases, including CTSS and CTSL, leaving a small fragment termed CLIP (class-II-associated invariant chain peptide). The removal of CLIP is facilitated by HLA-DM via direct binding to the alpha-beta-CLIP complex so that CLIP is released. HLA-DM stabilizes MHC class II molecules until primary high affinity antigenic peptides are bound. The MHC II molecule bound to a peptide is then transported to the cell membrane surface. In B-cells, the interaction between HLA-DM and MHC class II molecules is regulated by HLA-DO. Primary dendritic cells (DCs) also to express HLA-DO. Lysosomal microenvironment has been implicated in the regulation of antigen loading into MHC II molecules, increased acidification produces increased proteolysis and efficient peptide loading. Belongs to the MHC class II family. Heterodimer of an alpha and a beta subunit; also referred as MHC class II molecule. Dimer formation with HLA-DQA2, but not with HLA-DQA1, is required for efficient exit from the endoplasmic reticulum (ER). In the ER, forms a heterononamer; 3 MHC class II molecules bind to a CD74 homotrimer (also known as invariant chain or HLA class II histocompatibility antigen gamma chain). In the endosomal/lysosomal system; CD74 undergoes sequential degradation by various proteases; leaving a small fragment termed CLIP on each MHC class II molecule. MHC class II molecule interacts with HLA_DM, and HLA_DO in B-cells, in order to release CLIP and facilitate the binding of antigenic peptides. Association with HLA-DMA also occurs in skin Langerhans cells, in post-Golgi compartments. 2 isoforms of the human protein are produced by alternative splicing

Chromosomal Location of Human Ortholog: 6p21

Cellular Component: Golgi membrane; lysosomal membrane; plasma membrane; trans-Golgi network membrane

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; T cell costimulation; T cell receptor signaling pathway

Research Articles on HLA-DQB2

Similar Products

Product Notes

The HLA-DQB2 hla-dqb2 (Catalog #AAA1265733) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGTCTTGGA AGATGGCTCT GCAGATCCCT GGAGGCTTTT GGGCAGCAGC TGTGACCGTG ATGCTGGTGA TGCTGAGCAC CCCAGTGGCT GAGGCCAGAG ACTTTCCCAA GGATTTCTTG GTCCAGTTTA AGGGCATGTG CTACTTCACC AACGGGACAG AGCGCGTGCG GGGTGTGGCC AGATACATCT ATAACCGCGA GGAGTACGGG CGCTTCGACA GCGACGTTGG GGAGTTCCAG GCGGTGACCG AGCTGGGGCG GAGCATCGAG GACTGGAACA ACTATAAGGA CTTCTTGGAG CAGGAGCGGG CCGCGGTGGA CAAGGTGTGC AGACACAACT ACGAGGCGGA GCTACGCACG ACCTTGCAGC GGCAAGTGGA GCCCACAGTG ACCATCTCCC CATCCAGGAC AGAGGCCCTC AACCACCACA ACCTGCTGGT CTGCTCAGTG ACAGATTTCT ATCCAGCCCA GATCAAAGTC CAGTGGTTTC GGAATGACCA GGAGGAGACA GCCGGTGTTG TGTCCACCTC CCTCATTAGG AATGGTGACT GGACCTTCCA GATTCTGGTG ATGCTGGAAA TAACTCCCCA GCGTGGAGAC ATCTACACCT GCCAAGTGGA GCACCCCAGC CTCCAGAGCC CCATCACCGT GGAGTGGCGA CCTCGAGGGC CTCCACCTGC AGGACTCCTG CACTGA. It is sometimes possible for the material contained within the vial of "HLA-DQB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.