Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HLA-DMB cdna clone

HLA-DMB cDNA Clone

Gene Names
HLA-DMB; RING7; D6S221E
Synonyms
HLA-DMB; HLA-DMB cDNA Clone; HLA-DMB cdna clone
Ordering
For Research Use Only!
Sequence
atgatcacattcctgccgctgctgctggggctcagcctgggctgcacaggagcaggtggcttcgtggcccatgtggaaagcacctgtctgttggatgatgctgggactccaaaggatttcacatactgcatctccttcaacaaggatctgctgacctgctgggatccagaggagaataagatggccccttgcgaatttggggtgctgaatagcttggcgaatgtcctctcacagcacctcaaccaaaaagacaccctgatgcagcgcttgcgcaatgggcttcagaattgtgccacacacacccagcccttctggggatcactgaccaacaggacacggccaccatctgtgcaagtagccaaaaccactccttttaacacgagggagcctgtgatgctggcctgctatgtgtggggcttctatccagcagaagtgactatcacgtggaggaagaacgggaagcttgtcatgcctcacagcagtgcgcacaagactgcccagcccaatggagactggacataccagaccctctcccatttagccttaaccccctcttacggggacacttacacctgtgtggtagagcacattggggctcctgagcccatccttcgggactggacacctgggctgtcccccatgcagaccctgaaggtttctgtgtctgcagtgactctgggcctgggcctcatcatcttctctcttggtgtgatcagctggcggagagctggccactctagttacactcctcttcctgggtccaattattcagaaggatggcacatttcctag
Sequence Length
792
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,943 Da
NCBI Official Full Name
Homo sapiens major histocompatibility complex, class II, DM beta, mRNA
NCBI Official Synonym Full Names
major histocompatibility complex, class II, DM beta
NCBI Official Symbol
HLA-DMB
NCBI Official Synonym Symbols
RING7; D6S221E
NCBI Protein Information
HLA class II histocompatibility antigen, DM beta chain
UniProt Protein Name
HLA class II histocompatibility antigen, DM beta chain
UniProt Gene Name
HLA-DMB
UniProt Synonym Gene Names
DMB; RING7
UniProt Entry Name
DMB_HUMAN

NCBI Description

HLA-DMB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta (DMB) chain, both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP (class II-associated invariant chain peptide) molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]

Uniprot Description

HLA-DMB: Plays a critical role in catalyzing the release of class II-associated invariant chain peptide (CLIP) from newly synthesized MHC class II molecules and freeing the peptide binding site for acquisition of antigenic peptides. In B-cells, the interaction between HLA-DM and MHC class II molecules is regulated by HLA-DO. Belongs to the MHC class II family.

Protein type: Vesicle; Membrane protein, integral

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: lysosomal membrane; MHC class II protein complex

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; MHC class II protein complex assembly; peptide antigen assembly with MHC class II protein complex; positive regulation of T cell proliferation

Research Articles on HLA-DMB

Similar Products

Product Notes

The HLA-DMB hla-dmb (Catalog #AAA1276367) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatcacat tcctgccgct gctgctgggg ctcagcctgg gctgcacagg agcaggtggc ttcgtggccc atgtggaaag cacctgtctg ttggatgatg ctgggactcc aaaggatttc acatactgca tctccttcaa caaggatctg ctgacctgct gggatccaga ggagaataag atggcccctt gcgaatttgg ggtgctgaat agcttggcga atgtcctctc acagcacctc aaccaaaaag acaccctgat gcagcgcttg cgcaatgggc ttcagaattg tgccacacac acccagccct tctggggatc actgaccaac aggacacggc caccatctgt gcaagtagcc aaaaccactc cttttaacac gagggagcct gtgatgctgg cctgctatgt gtggggcttc tatccagcag aagtgactat cacgtggagg aagaacggga agcttgtcat gcctcacagc agtgcgcaca agactgccca gcccaatgga gactggacat accagaccct ctcccattta gccttaaccc cctcttacgg ggacacttac acctgtgtgg tagagcacat tggggctcct gagcccatcc ttcgggactg gacacctggg ctgtccccca tgcagaccct gaaggtttct gtgtctgcag tgactctggg cctgggcctc atcatcttct ctcttggtgt gatcagctgg cggagagctg gccactctag ttacactcct cttcctgggt ccaattattc agaaggatgg cacatttcct ag. It is sometimes possible for the material contained within the vial of "HLA-DMB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.