Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HLA-C cdna clone

HLA-C cDNA Clone

Gene Names
HLA-C; MHC; HLAC; HLC-C; D6S204; PSORS1; HLA-JY3
Synonyms
HLA-C; HLA-C cDNA Clone; HLA-C cdna clone
Ordering
For Research Use Only!
Sequence
atgcgggtcatggcgccccgaaccctcatcctgctgctctcgggagccctggccctgaccgagacctgggcctgctcccactccatgaggtatttctacaccgccgtgtcccggcccggccgcggagagccccgcttcatcgcagtgggctacgtggacgacacgcagttcgtgcggttcgacagcgacgccgcgagtccaagaggggagccgcgggcgccgtgggtggagcaggaggggccggagtattgggaccgggagacacagaagtacaagcgccaggcacagactgaccgagtgagcctgcggaacctgcgcggctactacaaccagagcgaggccgggtctcacaccctccagtggatgtatggctgcgacctggggcccgacgggcgcctcctccgcgggtatgaccagtccgcctacgacggcaaggattacatcgccctgaacgaggacctgcgctcctggaccgccgcggacacggcggctcagatcacccagcgcaagtgggaggcggcccgtgcggcggagcagcagagagcctacctggagggcacgtgcgtggagtggctccgcagatacctggagaacgggaaggagacgctgcagcgcgcggaacacccaaagacacacgtgacccaccatctcgtctctgaccatgaggccaccctgaggtgctgggccctgggcttctaccctgcggagatcacactgacctggcagcgggatggcgaggaccaaactcaggacaccgagcttgtggagaccaggccagcaggagatggaaccttccagaagtgggcagctgtggtggtgccttctggagaagagcagagatacacgtgccatgtgcagcacgaggggctgccggagcccctcaccctgagatgggagccatcttcccagcccaccatccccatcgtgggcatcgttgctggcctggctgtcctggctgtcctagctgtcctaggagctgtggtggctgttgttatgtgtaggaggaagagctcaggtggaaaaggagggagctgctctcaggctgcgtccagcaacagtgcccagggctctgatgagtctctcatcgcttgtaaagcctga
Sequence Length
1101
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,965 Da
NCBI Official Full Name
Homo sapiens major histocompatibility complex, class I, C, mRNA
NCBI Official Synonym Full Names
major histocompatibility complex, class I, C
NCBI Official Symbol
HLA-C
NCBI Official Synonym Symbols
MHC; HLAC; HLC-C; D6S204; PSORS1; HLA-JY3
NCBI Protein Information
HLA class I histocompatibility antigen, Cw-1 alpha chain
UniProt Protein Name
HLA class I histocompatibility antigen, Cw-1 alpha chain
UniProt Gene Name
HLA-C
UniProt Synonym Gene Names
HLAC
UniProt Entry Name
1C01_HUMAN

NCBI Description

HLA-C belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from endoplasmic reticulum lumen. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. Over one hundred HLA-C alleles have been described [provided by RefSeq, Jul 2008]

Uniprot Description

HLAC iso2: Involved in the presentation of foreign antigens to the immune system. Belongs to the MHC class I family.

Protein type: Receptor, misc.; Membrane protein, integral

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: cell surface; early endosome membrane; endoplasmic reticulum; Golgi apparatus; Golgi membrane; MHC class I protein complex; phagocytic vesicle membrane; plasma membrane

Molecular Function: antigen binding; peptide antigen binding

Biological Process: antigen processing and presentation; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent; antigen processing and presentation of peptide antigen via MHC class I; regulation of immune response

Disease: Psoriasis 1, Susceptibility To

Research Articles on HLA-C

Similar Products

Product Notes

The HLA-C hla-c (Catalog #AAA1275151) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgggtca tggcgccccg aaccctcatc ctgctgctct cgggagccct ggccctgacc gagacctggg cctgctccca ctccatgagg tatttctaca ccgccgtgtc ccggcccggc cgcggagagc cccgcttcat cgcagtgggc tacgtggacg acacgcagtt cgtgcggttc gacagcgacg ccgcgagtcc aagaggggag ccgcgggcgc cgtgggtgga gcaggagggg ccggagtatt gggaccggga gacacagaag tacaagcgcc aggcacagac tgaccgagtg agcctgcgga acctgcgcgg ctactacaac cagagcgagg ccgggtctca caccctccag tggatgtatg gctgcgacct ggggcccgac gggcgcctcc tccgcgggta tgaccagtcc gcctacgacg gcaaggatta catcgccctg aacgaggacc tgcgctcctg gaccgccgcg gacacggcgg ctcagatcac ccagcgcaag tgggaggcgg cccgtgcggc ggagcagcag agagcctacc tggagggcac gtgcgtggag tggctccgca gatacctgga gaacgggaag gagacgctgc agcgcgcgga acacccaaag acacacgtga cccaccatct cgtctctgac catgaggcca ccctgaggtg ctgggccctg ggcttctacc ctgcggagat cacactgacc tggcagcggg atggcgagga ccaaactcag gacaccgagc ttgtggagac caggccagca ggagatggaa ccttccagaa gtgggcagct gtggtggtgc cttctggaga agagcagaga tacacgtgcc atgtgcagca cgaggggctg ccggagcccc tcaccctgag atgggagcca tcttcccagc ccaccatccc catcgtgggc atcgttgctg gcctggctgt cctggctgtc ctagctgtcc taggagctgt ggtggctgtt gttatgtgta ggaggaagag ctcaggtgga aaaggaggga gctgctctca ggctgcgtcc agcaacagtg cccagggctc tgatgagtct ctcatcgctt gtaaagcctg a. It is sometimes possible for the material contained within the vial of "HLA-C, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.