Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HK2 cdna clone

HK2 cDNA Clone

Gene Names
HK2; HKII; HXK2
Synonyms
HK2; HK2 cDNA Clone; HK2 cdna clone
Ordering
For Research Use Only!
Sequence
atgattgcctcgcatctgcttgcctacttcttcacggagctcaaccatgaccaagtgcagaaggttgaccagtatctctaccacatgcgcctctctgatgagaccctcttggagatctctaagcggttccgcaaggagatggagaaagggcttggagccaccactcaccctactgcagcagtgaagatgctgcccacctttgtgaggtccactccagatgggacagaacacggagagttcctggctctggatcttggagggaccaacttccgtgtgctttgggtgaaagtaacggacaatgggctccagaaggtggagatggagaatcagatctatgccatccctgaggacatcatgcgaggcagtggcacccagctgtttgaccacattgccgaatgcctggctaacttcatggataagctacaaatcaaagacaagaagctcccactgggttttaccttctcgttcccctgccaccagactaaactagacgagagtttcctggtctcatggaccaagggattcaagtccagtggagtggaaggcagagacgttgtggctctgatccggaaggccatccagaggagaggggactttgatatcgacattgtggctgtggtgaatgacacagttgggaccatgatgacctgtggttatgatgaccacaactgtgagattggtctcattgtgggcacgggcagcaacgcctgctacatggaagagatgcgccacatcgacatggtggaaggcgatgaggggcggatgtgtatcaatatggagtggggggccttcggggacgatggctcgctcaacgacattcgcactgagtttgaccaggagattgacatgggctcactgaacccgggaaagcaactgtttgagaagatgatcagtgggatgtacatgggggagctggtgaggcttatcctggtgaagatggccaaggaggagctgctctttggggggaagctcagcccagagcttctcaacaccggtcgctttgagaccaaagacatctcagacattgaaggggagaaggatggcatccggaaggcccgtgaggtcctgatgcggttgggcctggacccgactcaggaggactgcgtggccactcaccggatctgccagatcgtgtccacacgctccgccagcctgtgcgcagccaccctggccgccgtgctgcagcgcatcaaggagaacaaaggcgaggagcggctgcgctctactattggggtcgacggttccgtctacaagaaacacccccattttgccaagcgtctacataagaccgtgcggcggctggtgcccggctgcgatgtccgcttcctccgctccgaggatggcagtggcaaaggtgcagccatggtgacagcagtggcttaccggctggccgatcaacaccgtgcccgccagaagacattagagcatctgcagctgagccatgaccagctgctggaggtcaagaggaggatgaaggtagaaatggagcgaggtctgagcaaggagactcatgccagtgcccccgtcaagatgctgcccacctacgtgtgtgctaccccggacggcacagagaaaggggacttcttggccttggaccttggaggaacaaatttccgggtcctgctggtccgtgttcggaatgggaagtggggtggagtggagatgcacaacaagatctacgccatcccgcaggaggtcatgcacggcaccggggacgagctctttgaccacattgtccagtgcatcgcggacttcctcgagtacatgggcatgaagggcgtgtccctgcctctgggttttaccttctccttcccctgccagcagaacagcctggacgagagcatcctcctcaagtggacaaaaggcttcaaggcatctggctgcgagggcgaggacgtggtgaccctgctgaaggaagcgatccaccggcgagaggagtttgacctggatgtggttgctgtggtgaacgacacagtcggaactatgatgacctgtggctttgaagaccctcactgtgaagttggcctcattgttggcacgggcagcaatgcctgctacatggaggagatgcgcaacgtggaactggtggaaggagaagaggggcggatgtgtgtgaacatggaatggggggccttcggggacaatggatgcctagatgacttccgcacagaatttgatgtggctgtggatgagctttcactcaaccccggcaagcagaggttcgagaaaatgatcagtggaatgtacctgggtgagattgtccgtaacattctcatcgatttcaccaagcgtggactgctcttccgaggccgcatctcagagcggctcaagacaaggggcatctttgaaaccaagttcttgtctcagattgagagtgactgcctggccctgctgcaagtccgagccatcctgcaacacttagggcttgagagcacctgtgacgacagcatcattgttaaggaggtgtgcactgtggtggcccggcgggcagcccagctctgtggcgcaggcatggccgctgtggtggacaggatacgagaaaaccgtgggctggacgctctcaaagtgacagtgggtgtggatgggaccctctacaagctacatcctcactttgccaaagtcatgcatgagacagtgaaggacctggctccgaaatgtgatgtgtctttcctgcagtcagaggatggcagcgggaagggggcggcgctcatcactgctgtggcctgccgcatccgtgaggctggacagcgatag
Sequence Length
2754
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
102,380 Da
NCBI Official Full Name
Homo sapiens hexokinase 2, mRNA
NCBI Official Synonym Full Names
hexokinase 2
NCBI Official Symbol
HK2
NCBI Official Synonym Symbols
HKII; HXK2
NCBI Protein Information
hexokinase-2
UniProt Protein Name
Hexokinase-2
Protein Family
UniProt Gene Name
HK2
UniProt Synonym Gene Names
HK II
UniProt Entry Name
HXK2_HUMAN

NCBI Description

Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 2, the predominant form found in skeletal muscle. It localizes to the outer membrane of mitochondria. Expression of this gene is insulin-responsive, and studies in rat suggest that it is involved in the increased rate of glycolysis seen in rapidly growing cancer cells. [provided by RefSeq, Apr 2009]

Uniprot Description

HK2: a glycolytic enzyme that catalyzes the reaction ATP + D-hexose = ADP + D-hexose 6-phosphate. The first and rate-limiting step in glycosis, a pathway that produces energy in the form of ATP from glucose. An allosteric enzyme inhibited by its product glucose-6-phosphate (Glc-6-P). The predominant hexokinase isozyme expressed in insulin-responsive tissues such as skeletal muscle. Acts as a ""glucose sensor"" by trapping glucose inside the cell by catalyzing its phosphorylation to produce Glc-6-P. In vertebrates there are four major glucose-phosphorylating isoenzymes, designated hexokinase I, II, III and IV (glucokinase). Genetic variations of HK2 do not appear to contribute to NIDDM.

Protein type: EC 2.7.1.1; Kinase, other; Mitochondrial; Carbohydrate Metabolism - glycolysis and gluconeogenesis; Carbohydrate Metabolism - starch and sucrose; Carbohydrate Metabolism - galactose; Carbohydrate Metabolism - fructose and mannose; Carbohydrate Metabolism - amino sugar and nucleotide sugar

Chromosomal Location of Human Ortholog: 2p13

Cellular Component: cytosol; membrane; mitochondrial outer membrane

Molecular Function: fructokinase activity; glucokinase activity; hexokinase activity; mannokinase activity; protein binding

Biological Process: apoptotic mitochondrial changes; cell glucose homeostasis; glucose transport; glycolysis

Research Articles on HK2

Similar Products

Product Notes

The HK2 hk2 (Catalog #AAA1278122) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattgcct cgcatctgct tgcctacttc ttcacggagc tcaaccatga ccaagtgcag aaggttgacc agtatctcta ccacatgcgc ctctctgatg agaccctctt ggagatctct aagcggttcc gcaaggagat ggagaaaggg cttggagcca ccactcaccc tactgcagca gtgaagatgc tgcccacctt tgtgaggtcc actccagatg ggacagaaca cggagagttc ctggctctgg atcttggagg gaccaacttc cgtgtgcttt gggtgaaagt aacggacaat gggctccaga aggtggagat ggagaatcag atctatgcca tccctgagga catcatgcga ggcagtggca cccagctgtt tgaccacatt gccgaatgcc tggctaactt catggataag ctacaaatca aagacaagaa gctcccactg ggttttacct tctcgttccc ctgccaccag actaaactag acgagagttt cctggtctca tggaccaagg gattcaagtc cagtggagtg gaaggcagag acgttgtggc tctgatccgg aaggccatcc agaggagagg ggactttgat atcgacattg tggctgtggt gaatgacaca gttgggacca tgatgacctg tggttatgat gaccacaact gtgagattgg tctcattgtg ggcacgggca gcaacgcctg ctacatggaa gagatgcgcc acatcgacat ggtggaaggc gatgaggggc ggatgtgtat caatatggag tggggggcct tcggggacga tggctcgctc aacgacattc gcactgagtt tgaccaggag attgacatgg gctcactgaa cccgggaaag caactgtttg agaagatgat cagtgggatg tacatggggg agctggtgag gcttatcctg gtgaagatgg ccaaggagga gctgctcttt ggggggaagc tcagcccaga gcttctcaac accggtcgct ttgagaccaa agacatctca gacattgaag gggagaagga tggcatccgg aaggcccgtg aggtcctgat gcggttgggc ctggacccga ctcaggagga ctgcgtggcc actcaccgga tctgccagat cgtgtccaca cgctccgcca gcctgtgcgc agccaccctg gccgccgtgc tgcagcgcat caaggagaac aaaggcgagg agcggctgcg ctctactatt ggggtcgacg gttccgtcta caagaaacac ccccattttg ccaagcgtct acataagacc gtgcggcggc tggtgcccgg ctgcgatgtc cgcttcctcc gctccgagga tggcagtggc aaaggtgcag ccatggtgac agcagtggct taccggctgg ccgatcaaca ccgtgcccgc cagaagacat tagagcatct gcagctgagc catgaccagc tgctggaggt caagaggagg atgaaggtag aaatggagcg aggtctgagc aaggagactc atgccagtgc ccccgtcaag atgctgccca cctacgtgtg tgctaccccg gacggcacag agaaagggga cttcttggcc ttggaccttg gaggaacaaa tttccgggtc ctgctggtcc gtgttcggaa tgggaagtgg ggtggagtgg agatgcacaa caagatctac gccatcccgc aggaggtcat gcacggcacc ggggacgagc tctttgacca cattgtccag tgcatcgcgg acttcctcga gtacatgggc atgaagggcg tgtccctgcc tctgggtttt accttctcct tcccctgcca gcagaacagc ctggacgaga gcatcctcct caagtggaca aaaggcttca aggcatctgg ctgcgagggc gaggacgtgg tgaccctgct gaaggaagcg atccaccggc gagaggagtt tgacctggat gtggttgctg tggtgaacga cacagtcgga actatgatga cctgtggctt tgaagaccct cactgtgaag ttggcctcat tgttggcacg ggcagcaatg cctgctacat ggaggagatg cgcaacgtgg aactggtgga aggagaagag gggcggatgt gtgtgaacat ggaatggggg gccttcgggg acaatggatg cctagatgac ttccgcacag aatttgatgt ggctgtggat gagctttcac tcaaccccgg caagcagagg ttcgagaaaa tgatcagtgg aatgtacctg ggtgagattg tccgtaacat tctcatcgat ttcaccaagc gtggactgct cttccgaggc cgcatctcag agcggctcaa gacaaggggc atctttgaaa ccaagttctt gtctcagatt gagagtgact gcctggccct gctgcaagtc cgagccatcc tgcaacactt agggcttgag agcacctgtg acgacagcat cattgttaag gaggtgtgca ctgtggtggc ccggcgggca gcccagctct gtggcgcagg catggccgct gtggtggaca ggatacgaga aaaccgtggg ctggacgctc tcaaagtgac agtgggtgtg gatgggaccc tctacaagct acatcctcac tttgccaaag tcatgcatga gacagtgaag gacctggctc cgaaatgtga tgtgtctttc ctgcagtcag aggatggcag cgggaagggg gcggcgctca tcactgctgt ggcctgccgc atccgtgagg ctggacagcg atag. It is sometimes possible for the material contained within the vial of "HK2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.