Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HIBCH cdna clone

HIBCH cDNA Clone

Gene Names
HIBCH; HIBYLCOAH
Synonyms
HIBCH; HIBCH cDNA Clone; HIBCH cdna clone
Ordering
For Research Use Only!
Sequence
atgtggaggctcatgtcgaggtttaatgcattcaaaaggactaataccatactgcaccatttgagaatgtccaagcacacagatgcagcagaagaggtgctattggaaaaaaaaggttgcgcgggagtcataacactaaacagaccaaagttcctcaatgcactgactcttaatatgattcggcagatttatccacagctaaagaagtgggaacaagatcctgaaactttcctgatcattataaagggagcaggaggaaaggctttctgtgccgggggtgatatcagagtgatctcggaagctgaaaaggcaaaacagaagatagctccagttttcttcagagaagaatatatgctgaataatgctgttggttcttgccagaaaccttatgttgcacttattcatggaattacaatgggtgggggagttggtctctcagtccatgggcaatttcgagtggctacagaaaagtgtctttttgctatgccagaaactgcaataggactgttccctgatgtgggtggaggttatttcttgccacgactccaaggaaaacttggttacttccttgcattaacaggattcagactaaaaggaagagatgtgtacagagcaggaattgctacacactttgtagattctgaaaagttggccatgttagaggaagatttgttagccttgaaatctccttcaaaagaaaatattgcatctgtcttagaaaattaccatacagagtctaagattgatcgagacaagtcttttatacttgaggaacacatggacaaaataaacagttgtttttcagccaatactgtggaagaaattattgaaaacttacagcaagatggttcatcttttgccctagagcaattgaaggtaattaataaaatgtctccaacatctctaaagatcacactaaggcaactcatggaggggtcttcaaagaccttgcaagaagtactaactatggagtatcggctaagtcaagcttgtatgttttaa
Sequence Length
1002
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,012 Da
NCBI Official Full Name
Homo sapiens 3-hydroxyisobutyryl-Coenzyme A hydrolase, mRNA
NCBI Official Synonym Full Names
3-hydroxyisobutyryl-CoA hydrolase
NCBI Official Symbol
HIBCH
NCBI Official Synonym Symbols
HIBYLCOAH
NCBI Protein Information
3-hydroxyisobutyryl-CoA hydrolase, mitochondrial
UniProt Protein Name
3-hydroxyisobutyryl-CoA hydrolase, mitochondrial
UniProt Gene Name
HIBCH
UniProt Synonym Gene Names
HIB-CoA hydrolase; HIBYL-CoA-H
UniProt Entry Name
HIBCH_HUMAN

NCBI Description

This gene encodes the enzyme responsible for hydrolysis of both HIBYL-CoA and beta-hydroxypropionyl-CoA. Mutations in this gene have been associated with 3-hyroxyisobutyryl-CoA hydrolase deficiency. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]

Uniprot Description

HIBCH: Hydrolyzes 3-hydroxyisobutyryl-CoA (HIBYL-CoA), a saline catabolite. Has high activity toward isobutyryl-CoA. Could be an isobutyryl-CoA dehydrogenase that functions in valine catabolism. Also hydrolyzes 3-hydroxypropanoyl-CoA. Defects in HIBCH are the cause of HIBCH deficiency (HIBCHD); also known as deficiency of beta- hydroxyisobutyryl CoA deacylase or methacrylic aciduria. The enzyme defect results in accumulation of methacrylyl-CoA, a highly reactive compound, which readily undergoes addition reactions with free sulfhydryl groups. Affected individuals showed delayed development of motor skills, hypotonia, initial poor feeding, and a deterioration in neurological function during first stages of life. Belongs to the enoyl-CoA hydratase/isomerase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.1.2.4; Carbohydrate Metabolism - propanoate; Mitochondrial; Hydrolase; Other Amino Acids Metabolism - beta-alanine; Amino Acid Metabolism - valine, leucine and isoleucine degradation

Chromosomal Location of Human Ortholog: 2q32.2

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: 3-hydroxyisobutyryl-CoA hydrolase activity

Biological Process: branched chain family amino acid catabolic process; fatty acid beta-oxidation

Disease: Beta-hydroxyisobutyryl Coa Deacylase Deficiency

Research Articles on HIBCH

Similar Products

Product Notes

The HIBCH hibch (Catalog #AAA1269956) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggaggc tcatgtcgag gtttaatgca ttcaaaagga ctaataccat actgcaccat ttgagaatgt ccaagcacac agatgcagca gaagaggtgc tattggaaaa aaaaggttgc gcgggagtca taacactaaa cagaccaaag ttcctcaatg cactgactct taatatgatt cggcagattt atccacagct aaagaagtgg gaacaagatc ctgaaacttt cctgatcatt ataaagggag caggaggaaa ggctttctgt gccgggggtg atatcagagt gatctcggaa gctgaaaagg caaaacagaa gatagctcca gttttcttca gagaagaata tatgctgaat aatgctgttg gttcttgcca gaaaccttat gttgcactta ttcatggaat tacaatgggt gggggagttg gtctctcagt ccatgggcaa tttcgagtgg ctacagaaaa gtgtcttttt gctatgccag aaactgcaat aggactgttc cctgatgtgg gtggaggtta tttcttgcca cgactccaag gaaaacttgg ttacttcctt gcattaacag gattcagact aaaaggaaga gatgtgtaca gagcaggaat tgctacacac tttgtagatt ctgaaaagtt ggccatgtta gaggaagatt tgttagcctt gaaatctcct tcaaaagaaa atattgcatc tgtcttagaa aattaccata cagagtctaa gattgatcga gacaagtctt ttatacttga ggaacacatg gacaaaataa acagttgttt ttcagccaat actgtggaag aaattattga aaacttacag caagatggtt catcttttgc cctagagcaa ttgaaggtaa ttaataaaat gtctccaaca tctctaaaga tcacactaag gcaactcatg gaggggtctt caaagacctt gcaagaagta ctaactatgg agtatcggct aagtcaagct tgtatgtttt aa. It is sometimes possible for the material contained within the vial of "HIBCH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.