Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HEYL cdna clone

HEYL cDNA Clone

Gene Names
HEYL; HEY3; HRT3; HESR3; bHLHb33
Synonyms
HEYL; HEYL cDNA Clone; HEYL cdna clone
Ordering
For Research Use Only!
Sequence
atgaagcgacccaaggagccgagcggctccgacggggagtccgacggacccatcgacgtgggccaagagggccagctgagccagatggccaggccgctgtccacccccagctcttcgcagatgcaagccaggaagaaacgcagagggatcatagagaaacggcgtcgagaccgcatcaacagtagcctttctgaattgcgacgcttggtccccactgcctttgagaaacagggctcttccaagctggagaaagccgaggtcttgcagatgacggtggatcacttgaaaatgctccatgccactggtgggacaggattctttgatgcccgagccctggcagttgacttccggagcattggttttcgggagtgcctcactgaggtcatcaggtacctgggggtccttgaagggcccagcagccgtgcagaccccgtccggattcgccttctctcccacctcaacagctacgcagccgagatggagccttcgcccacgcccactggccctttggccttccctgcctggccctggtctttcttccatagctgtccagggctgccagccctgagcaaccagctcgccatcctgggaagagtgcccagccctgtcctccccggtgtctcctctcctgcttaccccatcccagccctccgaaccgctccccttcgcagagccacaggcatcatcctgccagcccggaggaatgtgctgcccagtcgaggggcatcttccacccggagggcccgccccctagagaggccagcgacccctgtgcctgtcgcccccagcagcagggctgccaggagcagccacatcgctcccctcctgcagtcttcctccccaacaccccctggtcctacagggtcggctgcttacgtggctgttcccacccccaactcatcctccccagggccagctgggaggccagcgggagccatgctctaccactcctgggtctctgaaatcactgaaatcggggctttctga
Sequence Length
987
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,087 Da
NCBI Official Full Name
Homo sapiens hairy/enhancer-of-split related with YRPW motif-like, mRNA
NCBI Official Synonym Full Names
hes related family bHLH transcription factor with YRPW motif-like
NCBI Official Symbol
HEYL
NCBI Official Synonym Symbols
HEY3; HRT3; HESR3; bHLHb33
NCBI Protein Information
hairy/enhancer-of-split related with YRPW motif-like protein
UniProt Protein Name
Hairy/enhancer-of-split related with YRPW motif-like protein
UniProt Gene Name
HEYL
UniProt Synonym Gene Names
BHLHB33; HRT3; hHeyL; bHLHb33; HRT-3; hHRT3
UniProt Entry Name
HEYL_HUMAN

NCBI Description

This gene encodes a member of the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcription factors. The sequence of the encoded protein contains a conserved bHLH and orange domain, but its YRPW motif has diverged from other HESR family members. It is thought to be an effector of Notch signaling and a regulator of cell fate decisions. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

HEYL: Downstream effector of Notch signaling which may be required for cardiovascular development. Transcriptional repressor which binds preferentially to the canonical E box sequence 5'-CACGTG-3'. Represses transcription by the cardiac transcriptional activators GATA4 and GATA6. Belongs to the HEY family.

Chromosomal Location of Human Ortholog: 1p34.3

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: AF-1 domain binding; protein binding; protein heterodimerization activity; transcription corepressor activity; transcription factor activity

Biological Process: mesenchymal cell development; negative regulation of transcription, DNA-dependent; Notch signaling pathway; positive regulation of neuron differentiation; positive regulation of transcription from RNA polymerase II promoter

Research Articles on HEYL

Similar Products

Product Notes

The HEYL heyl (Catalog #AAA1276370) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcgac ccaaggagcc gagcggctcc gacggggagt ccgacggacc catcgacgtg ggccaagagg gccagctgag ccagatggcc aggccgctgt ccacccccag ctcttcgcag atgcaagcca ggaagaaacg cagagggatc atagagaaac ggcgtcgaga ccgcatcaac agtagccttt ctgaattgcg acgcttggtc cccactgcct ttgagaaaca gggctcttcc aagctggaga aagccgaggt cttgcagatg acggtggatc acttgaaaat gctccatgcc actggtggga caggattctt tgatgcccga gccctggcag ttgacttccg gagcattggt tttcgggagt gcctcactga ggtcatcagg tacctggggg tccttgaagg gcccagcagc cgtgcagacc ccgtccggat tcgccttctc tcccacctca acagctacgc agccgagatg gagccttcgc ccacgcccac tggccctttg gccttccctg cctggccctg gtctttcttc catagctgtc cagggctgcc agccctgagc aaccagctcg ccatcctggg aagagtgccc agccctgtcc tccccggtgt ctcctctcct gcttacccca tcccagccct ccgaaccgct ccccttcgca gagccacagg catcatcctg ccagcccgga ggaatgtgct gcccagtcga ggggcatctt ccacccggag ggcccgcccc ctagagaggc cagcgacccc tgtgcctgtc gcccccagca gcagggctgc caggagcagc cacatcgctc ccctcctgca gtcttcctcc ccaacacccc ctggtcctac agggtcggct gcttacgtgg ctgttcccac ccccaactca tcctccccag ggccagctgg gaggccagcg ggagccatgc tctaccactc ctgggtctct gaaatcactg aaatcggggc tttctga. It is sometimes possible for the material contained within the vial of "HEYL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.