Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HEY1 cdna clone

HEY1 cDNA Clone

Gene Names
HEY1; CHF2; OAF1; HERP2; HESR1; HRT-1; hHRT1; BHLHb31
Synonyms
HEY1; HEY1 cDNA Clone; HEY1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagcgagctcaccccgagtacagctcctcggacagcgagctggacgagaccatcgaggtggagaaggagagtgcggacgagaatggaaacttgagttcggctctaggttccatgtccccaactacatcttcccagattttggccagaaaaagacggagaggaataattgagaagcgccgacgagaccggatcaataacagtttgtctgagctgagaaggctggtacccagtgcttttgagaagcagggatctgctaagctagaaaaagccgagatcctgcagatgaccgtggatcacctgaaaatgctgcatacggcaggagggaaaggttactttgacgcgcacgcccttgctatggactatcggagtttgggatttcgggaatgcctggcagaagttgcgcgttatctgagcatcattgaaggactagatgcctctgacccgcttcgagttcgactggtttcgcatctcaacaactacgcttcccagcgggaagccgcgagcggcgcccacgcgggcctcggacacattccctgggggaccgtcttcggacatcacccgcacatcgcgcacccgctgttgctgccccagaacggccacgggaacgcgggcaccacggcctcacccacggaaccgcaccaccagggcaggctgggctcggcacatccggaggcgcctgctttgcgagcgccccctagcggcagcctcggaccggtgctccctgtggtcacctccgcctccaaactgtcgccgcctctgctctcctcagtggcctccctgtcggccttccccttctctttcggctccttccacttactgtctcccaatgcactgagcccttcagcacccacgcaggctgcaaaccttggcaagccctatagaccttgggggacggagatcggagctttttaa
Sequence Length
915
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,100 Da
NCBI Official Full Name
Homo sapiens hairy/enhancer-of-split related with YRPW motif 1, mRNA
NCBI Official Synonym Full Names
hes related family bHLH transcription factor with YRPW motif 1
NCBI Official Symbol
HEY1
NCBI Official Synonym Symbols
CHF2; OAF1; HERP2; HESR1; HRT-1; hHRT1; BHLHb31
NCBI Protein Information
hairy/enhancer-of-split related with YRPW motif protein 1
UniProt Protein Name
Hairy/enhancer-of-split related with YRPW motif protein 1
UniProt Gene Name
HEY1
UniProt Synonym Gene Names
BHLHB31; CHF2; HERP2; HESR1; HRT1; CHF-2; bHLHb31; HESR-1; HRT-1; hHRT1
UniProt Entry Name
HEY1_HUMAN

NCBI Description

This gene encodes a nuclear protein belonging to the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcriptional repressors. Expression of this gene is induced by the Notch and c-Jun signal transduction pathways. Two similar and redundant genes in mouse are required for embryonic cardiovascular development, and are also implicated in neurogenesis and somitogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]

Uniprot Description

HEY1: Downstream effector of Notch signaling which may be required for cardiovascular development. Transcriptional repressor which binds preferentially to the canonical E box sequence 5'- CACGTG-3'. Represses transcription by the cardiac transcriptional activators GATA4 and GATA6. Belongs to the HEY family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear receptor co-regulator; Transcription factor

Chromosomal Location of Human Ortholog: 8q21

Cellular Component: cytoplasm; nucleoplasm; nucleus

Molecular Function: protein binding; transcription factor activity

Biological Process: angiogenesis; negative regulation of Notch signaling pathway; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; Notch signaling pathway; positive regulation of transcription from RNA polymerase II promoter

Research Articles on HEY1

Similar Products

Product Notes

The HEY1 hey1 (Catalog #AAA1271033) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagcgag ctcaccccga gtacagctcc tcggacagcg agctggacga gaccatcgag gtggagaagg agagtgcgga cgagaatgga aacttgagtt cggctctagg ttccatgtcc ccaactacat cttcccagat tttggccaga aaaagacgga gaggaataat tgagaagcgc cgacgagacc ggatcaataa cagtttgtct gagctgagaa ggctggtacc cagtgctttt gagaagcagg gatctgctaa gctagaaaaa gccgagatcc tgcagatgac cgtggatcac ctgaaaatgc tgcatacggc aggagggaaa ggttactttg acgcgcacgc ccttgctatg gactatcgga gtttgggatt tcgggaatgc ctggcagaag ttgcgcgtta tctgagcatc attgaaggac tagatgcctc tgacccgctt cgagttcgac tggtttcgca tctcaacaac tacgcttccc agcgggaagc cgcgagcggc gcccacgcgg gcctcggaca cattccctgg gggaccgtct tcggacatca cccgcacatc gcgcacccgc tgttgctgcc ccagaacggc cacgggaacg cgggcaccac ggcctcaccc acggaaccgc accaccaggg caggctgggc tcggcacatc cggaggcgcc tgctttgcga gcgcccccta gcggcagcct cggaccggtg ctccctgtgg tcacctccgc ctccaaactg tcgccgcctc tgctctcctc agtggcctcc ctgtcggcct tccccttctc tttcggctcc ttccacttac tgtctcccaa tgcactgagc ccttcagcac ccacgcaggc tgcaaacctt ggcaagccct atagaccttg ggggacggag atcggagctt tttaa. It is sometimes possible for the material contained within the vial of "HEY1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.