Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HERPUD2 cdna clone

HERPUD2 cDNA Clone

Synonyms
HERPUD2; HERPUD2 cDNA Clone; HERPUD2 cdna clone
Ordering
For Research Use Only!
Sequence
atggaccaaagtgggatggagattcctgtgaccctcatcattaaagcaccgaatcagaaatacagtgaccagactattagctgcttcttgaactggaccgtggggaaactaaaaacgcatctatctaacgtttaccctagcaaaccattgacgaaggatcagagattggtgtattcgggcagactgcttcccgatcatctgcagctgaaagacattctcagaaaacaagatgagtatcatatggttcatctagtatgtacttctcggactcctcccagttctccaaaatccagcaccaatagagaaagtcatgaagcattgacatccagcagcaattctagttcagatcattcaggatcaacaactccatcatctggtcaagaaaccttgtctttagctgtgggttcttcctcagaaggattgaggcagcgtacccttccacaagcacaaactgaccaagcacagagtcaccagtttccatatgtaatgcaaggaaatgtagacaaccaatttcctgggcaagctgctccacctggattcccagtgtatcccgcgtttagcccactgcagatgctatggtggcaacagatgtatgctcatcagtattatatgcagtatcaagctgcagtttcagctcaggccacatcaaatgtcaacccaacccagcctactacttcacagcctctaaatttggcacatgttcctggagaagaacccccaccagctccaaacctagtggcccaagaaaatcgacccatgaatgagaatgttcaaatgaatgcacagggaggtccagtactaaatgaagaagacttcaatcgagactggctagactggatgtacacgttctcacgagctgcgattctccttagcattgtatacttctattcttcttttagtcggtttatcatggtaatgggagccatgctactggtttatttacaccaagctggatggtttccttttaggcaagaaggaggtcatcagcaggctcccaacaataatgccgaagttaacaatgatgggcaaaatgcaaacaacttggaacttgaagaaatggagcgtcttatggatgatgggcttgaagatgagagtggagaagatggaggtgaagatgccagtgcaattcaaaggcctggattaatggcttcagcttggtctttcatcaccaccttctttacttcactaataccagaggggcctccccaggttgccaattga
Sequence Length
1221
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,147 Da
NCBI Official Full Name
Homo sapiens HERPUD family member 2, mRNA
NCBI Official Synonym Full Names
HERPUD family member 2
NCBI Official Symbol
HERPUD2
NCBI Protein Information
homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 2 protein
UniProt Protein Name
Homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 2 protein
UniProt Gene Name
HERPUD2
UniProt Entry Name
HERP2_HUMAN

Uniprot Description

HERPUD2: Could be involved in the unfolded protein response (UPR) pathway.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 7p14.2

Research Articles on HERPUD2

Similar Products

Product Notes

The HERPUD2 herpud2 (Catalog #AAA1273956) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaccaaa gtgggatgga gattcctgtg accctcatca ttaaagcacc gaatcagaaa tacagtgacc agactattag ctgcttcttg aactggaccg tggggaaact aaaaacgcat ctatctaacg tttaccctag caaaccattg acgaaggatc agagattggt gtattcgggc agactgcttc ccgatcatct gcagctgaaa gacattctca gaaaacaaga tgagtatcat atggttcatc tagtatgtac ttctcggact cctcccagtt ctccaaaatc cagcaccaat agagaaagtc atgaagcatt gacatccagc agcaattcta gttcagatca ttcaggatca acaactccat catctggtca agaaaccttg tctttagctg tgggttcttc ctcagaagga ttgaggcagc gtacccttcc acaagcacaa actgaccaag cacagagtca ccagtttcca tatgtaatgc aaggaaatgt agacaaccaa tttcctgggc aagctgctcc acctggattc ccagtgtatc ccgcgtttag cccactgcag atgctatggt ggcaacagat gtatgctcat cagtattata tgcagtatca agctgcagtt tcagctcagg ccacatcaaa tgtcaaccca acccagccta ctacttcaca gcctctaaat ttggcacatg ttcctggaga agaaccccca ccagctccaa acctagtggc ccaagaaaat cgacccatga atgagaatgt tcaaatgaat gcacagggag gtccagtact aaatgaagaa gacttcaatc gagactggct agactggatg tacacgttct cacgagctgc gattctcctt agcattgtat acttctattc ttcttttagt cggtttatca tggtaatggg agccatgcta ctggtttatt tacaccaagc tggatggttt ccttttaggc aagaaggagg tcatcagcag gctcccaaca ataatgccga agttaacaat gatgggcaaa atgcaaacaa cttggaactt gaagaaatgg agcgtcttat ggatgatggg cttgaagatg agagtggaga agatggaggt gaagatgcca gtgcaattca aaggcctgga ttaatggctt cagcttggtc tttcatcacc accttcttta cttcactaat accagagggg cctccccagg ttgccaattg a. It is sometimes possible for the material contained within the vial of "HERPUD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.