Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HERPUD1 cdna clone

HERPUD1 cDNA Clone

Gene Names
HERPUD1; SUP; HERP; Mif1
Synonyms
HERPUD1; HERPUD1 cDNA Clone; HERPUD1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagtccgagaccgaacccgagcccgtcacgctcctggtgaagagccccaaccagcgccaccgcgacttggagctgagtggcgaccgcggctggagtgtgggccacctcaaggcccacctgagccgcgtctaccccgagcgtccgcgtccagaggaccagaggttaatttattctgggaagctgttgttggatcaccaatgtctcagggacttgcttccaaaggaaaaacggcatgttttgcatctggtgtgcaatgtgaagagtccttcaaaaatgccagaaatcaacgccaaggtggctgaatccacagaggagcctgctggttctaatcggggacagtatcctgaggattcctcaagtgatggtttaaggcaaagggaagttcttcggaacctttcttcccctggatgggaaaacatctcaaggcatcacgttgggtggtttccatttagaccgaggccggttcagaacttcccaaatgatggtcctcctcctgacgttgtaaatcaggaccccaacaataacttacaggaaggcactgatcctgaaactgaagaccccaaccacctccctccagacagggatgtactagatggcgagcagaccagcccctcctttatgagcacagcatggcttgtcttcaagactttctttgcctctcttcttccagaaggccccccagccatcgcaaactga
Sequence Length
699
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,851 Da
NCBI Official Full Name
Homo sapiens homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1, mRNA
NCBI Official Synonym Full Names
homocysteine inducible ER protein with ubiquitin like domain 1
NCBI Official Symbol
HERPUD1
NCBI Official Synonym Symbols
SUP; HERP; Mif1
NCBI Protein Information
homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein
UniProt Protein Name
Homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein
UniProt Gene Name
HERPUD1
UniProt Synonym Gene Names
HERP; KIAA0025; MIF1
UniProt Entry Name
HERP1_HUMAN

NCBI Description

The accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggers the ER stress response. This response includes the inhibition of translation to prevent further accumulation of unfolded proteins, the increased expression of proteins involved in polypeptide folding, known as the unfolded protein response (UPR), and the destruction of misfolded proteins by the ER-associated protein degradation (ERAD) system. This gene may play a role in both UPR and ERAD. Its expression is induced by UPR and it has an ER stress response element in its promoter region while the encoded protein has an N-terminal ubiquitin-like domain which may interact with the ERAD system. This protein has been shown to interact with presenilin proteins and to increase the level of amyloid-beta protein following its overexpression. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. The full-length nature of all transcript variants has not been determined. [provided by RefSeq, Jan 2013]

Uniprot Description

HERPUD1: Component of the endoplasmic reticulum quality control (ERQC) system also called ER-associated degradation (ERAD) involved in ubiquitin-dependent degradation of misfolded endoplasmic reticulum proteins. Could enhance presenilin-mediated beta-amyloid protein 40 generation. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 16q13

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; membrane

Molecular Function: protein binding

Biological Process: endoplasmic reticulum calcium ion homeostasis; response to unfolded protein; retrograde protein transport, ER to cytosol

Research Articles on HERPUD1

Similar Products

Product Notes

The HERPUD1 herpud1 (Catalog #AAA1269048) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtccg agaccgaacc cgagcccgtc acgctcctgg tgaagagccc caaccagcgc caccgcgact tggagctgag tggcgaccgc ggctggagtg tgggccacct caaggcccac ctgagccgcg tctaccccga gcgtccgcgt ccagaggacc agaggttaat ttattctggg aagctgttgt tggatcacca atgtctcagg gacttgcttc caaaggaaaa acggcatgtt ttgcatctgg tgtgcaatgt gaagagtcct tcaaaaatgc cagaaatcaa cgccaaggtg gctgaatcca cagaggagcc tgctggttct aatcggggac agtatcctga ggattcctca agtgatggtt taaggcaaag ggaagttctt cggaaccttt cttcccctgg atgggaaaac atctcaaggc atcacgttgg gtggtttcca tttagaccga ggccggttca gaacttccca aatgatggtc ctcctcctga cgttgtaaat caggacccca acaataactt acaggaaggc actgatcctg aaactgaaga ccccaaccac ctccctccag acagggatgt actagatggc gagcagacca gcccctcctt tatgagcaca gcatggcttg tcttcaagac tttctttgcc tctcttcttc cagaaggccc cccagccatc gcaaactga. It is sometimes possible for the material contained within the vial of "HERPUD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.