Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HERC6 cdna clone

HERC6 cDNA Clone

Synonyms
HERC6; HERC6 cDNA Clone; HERC6 cdna clone
Ordering
For Research Use Only!
Sequence
atgcagatgtcagaaaagaaagcatacatgcttatgcatgaaacaattctgcaaaaaaaggatgaatttcctccatcacccagatttatacttagagtcagacgaagtcgcctggttaaagatgctctgcgtcaattaagtcaagctgaagctactgacttctgcaaagtattagtggttgaatttattaatgaaatttgtcctgagtctggaggggttagttcagagttcttccactgtatgtttgaagagatgaccaagccagaatatggaatgttcatgtatcctgaaatgggttcctgcatgtggtttcctgccaagcctaaacctgagaagaaaagatatttcctctttggaatgctgtgtggactctccttattcaatttaaatgttgctaaccttcctttcccactggctctgtataaaaaacttctggaccaaaagccatcattggaagatttaaaagaactcagtcctcggttggggaagagtttgcaagaagttctagatgatgctgctgatgacattggagatgcgctctgcatacgcttttctatacactgggaccaaaatgatgttgacttaattccaaatgggatctccatacctgtggaccaaaccaacaagagagactatgtttctaagtatattgattacattttcaacgtctctgtaaaagcagtttatgaggaatttcagagaggattttatagagtctgtgagaaggagatacttagacatttctaccctgaagaactaatgacagcaatcattggaaatactgattatgactggaaacagtttgaacagaattcaaagtatgagcaaggataccaaaaatcacatcctactatacagttgttttggaaggctttccacaaactaaccttggatgaaaagaaaaaattcctctttttccttacaggacgtgataggctgcatgcaagaggcatacagaaaatggaaatagtatttcgctgtcctgaaactttcagtgaaagagatcacccaacatcaataacttgtcataatattctctccctccctaagtattctacaatggaaagaatggaggaagcacttcaagtagccatcaacaacaacagaggatttgtctcacccatgctcacacagtcataa
Sequence Length
1140
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,717 Da
NCBI Official Full Name
Homo sapiens hect domain and RLD 6, mRNA
NCBI Official Synonym Full Names
HECT and RLD domain containing E3 ubiquitin protein ligase family member 6
NCBI Official Symbol
HERC6
NCBI Protein Information
probable E3 ubiquitin-protein ligase HERC6
UniProt Protein Name
Probable E3 ubiquitin-protein ligase HERC6
Protein Family
UniProt Gene Name
HERC6
UniProt Entry Name
HERC6_HUMAN

NCBI Description

HERC6 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008]

Uniprot Description

HERC6: E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.-; Ubiquitin conjugating system; Ligase

Chromosomal Location of Human Ortholog: 4q22.1

Cellular Component: cytoplasm; cytosol; nucleus

Molecular Function: ubiquitin-protein ligase activity

Biological Process: protein polyubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process

Research Articles on HERC6

Similar Products

Product Notes

The HERC6 herc6 (Catalog #AAA1278360) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagatgt cagaaaagaa agcatacatg cttatgcatg aaacaattct gcaaaaaaag gatgaatttc ctccatcacc cagatttata cttagagtca gacgaagtcg cctggttaaa gatgctctgc gtcaattaag tcaagctgaa gctactgact tctgcaaagt attagtggtt gaatttatta atgaaatttg tcctgagtct ggaggggtta gttcagagtt cttccactgt atgtttgaag agatgaccaa gccagaatat ggaatgttca tgtatcctga aatgggttcc tgcatgtggt ttcctgccaa gcctaaacct gagaagaaaa gatatttcct ctttggaatg ctgtgtggac tctccttatt caatttaaat gttgctaacc ttcctttccc actggctctg tataaaaaac ttctggacca aaagccatca ttggaagatt taaaagaact cagtcctcgg ttggggaaga gtttgcaaga agttctagat gatgctgctg atgacattgg agatgcgctc tgcatacgct tttctataca ctgggaccaa aatgatgttg acttaattcc aaatgggatc tccatacctg tggaccaaac caacaagaga gactatgttt ctaagtatat tgattacatt ttcaacgtct ctgtaaaagc agtttatgag gaatttcaga gaggatttta tagagtctgt gagaaggaga tacttagaca tttctaccct gaagaactaa tgacagcaat cattggaaat actgattatg actggaaaca gtttgaacag aattcaaagt atgagcaagg ataccaaaaa tcacatccta ctatacagtt gttttggaag gctttccaca aactaacctt ggatgaaaag aaaaaattcc tctttttcct tacaggacgt gataggctgc atgcaagagg catacagaaa atggaaatag tatttcgctg tcctgaaact ttcagtgaaa gagatcaccc aacatcaata acttgtcata atattctctc cctccctaag tattctacaa tggaaagaat ggaggaagca cttcaagtag ccatcaacaa caacagagga tttgtctcac ccatgctcac acagtcataa. It is sometimes possible for the material contained within the vial of "HERC6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.