Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HBXIP cdna clone

HBXIP cDNA Clone

Gene Names
LAMTOR5; XIP; HBXIP
Synonyms
HBXIP; HBXIP cDNA Clone; HBXIP cdna clone
Ordering
For Research Use Only!
Sequence
atggagccaggtgcaggtcacctcgacggtcaccgcgcggggagcccaagccttcgtcaggctctgtgcgacggaagcgcagtgatgttttccagtaaagaacgcggacgttgcaccgtgatcaattttgtccctttggaggcgccgttacggtccacgccccgctcgcgtcaagtgactgaggcctgtggtggagaaggacgtgccgtgccgctgggttctgagccggagtggtcggtgggtgggatggaggcgaccttggagcagcacttggaagacacaatgaagaatccctccattgttggagtcctgtgcacagattcacaaggacttaatctgggttgccgcgggaccctgtcagatgagcatgctggagtgatatctgttctagcccagcaagcagctaagctaacctctgaccccactgatattcctgtggtgtgtctagaatcagataatgggaacattatgatccagaaacacgatggcatcacggtggcagtgcacaaaatggcctcttga
Sequence Length
522
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,614 Da
NCBI Official Full Name
Homo sapiens hepatitis B virus x interacting protein, mRNA
NCBI Official Synonym Full Names
late endosomal/lysosomal adaptor, MAPK and MTOR activator 5
NCBI Official Symbol
LAMTOR5
NCBI Official Synonym Symbols
XIP; HBXIP
NCBI Protein Information
ragulator complex protein LAMTOR5
UniProt Protein Name
Ragulator complex protein LAMTOR5
UniProt Gene Name
LAMTOR5
UniProt Synonym Gene Names
HBXIP; XIP; HBV X-interacting protein; HBX-interacting protein
UniProt Entry Name
LTOR5_HUMAN

NCBI Description

This gene encodes a protein that specifically complexes with the C-terminus of hepatitis B virus X protein (HBx). The function of this protein is to negatively regulate HBx activity and thus to alter the replication life cycle of the virus. [provided by RefSeq, Jul 2008]

Uniprot Description

HBXIP: When complexed to BIRC5, interferes with apoptosome assembly, preventing recruitment of pro-caspase-9 to oligomerized APAF1, thereby selectively suppressing apoptosis initiated via the mitochondrial/cytochrome c pathway. Down-regulates hepatitis B virus (HBV) replication. Belongs to the HBXIP family.

Protein type: DNA replication; Apoptosis

Chromosomal Location of Human Ortholog: 1p13.3

Cellular Component: cytosol; lysosomal membrane; lysosome

Molecular Function: guanyl-nucleotide exchange factor activity; protein binding; protein complex scaffold

Biological Process: cell cycle arrest; macroautophagy; negative regulation of apoptosis; negative regulation of caspase activity; positive regulation of TOR signaling pathway; regulation of cell size; response to virus

Research Articles on HBXIP

Similar Products

Product Notes

The HBXIP lamtor5 (Catalog #AAA1273425) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagccag gtgcaggtca cctcgacggt caccgcgcgg ggagcccaag ccttcgtcag gctctgtgcg acggaagcgc agtgatgttt tccagtaaag aacgcggacg ttgcaccgtg atcaattttg tccctttgga ggcgccgtta cggtccacgc cccgctcgcg tcaagtgact gaggcctgtg gtggagaagg acgtgccgtg ccgctgggtt ctgagccgga gtggtcggtg ggtgggatgg aggcgacctt ggagcagcac ttggaagaca caatgaagaa tccctccatt gttggagtcc tgtgcacaga ttcacaagga cttaatctgg gttgccgcgg gaccctgtca gatgagcatg ctggagtgat atctgttcta gcccagcaag cagctaagct aacctctgac cccactgata ttcctgtggt gtgtctagaa tcagataatg ggaacattat gatccagaaa cacgatggca tcacggtggc agtgcacaaa atggcctctt ga. It is sometimes possible for the material contained within the vial of "HBXIP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.