Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HADHB cdna clone

HADHB cDNA Clone

Gene Names
HADHB; ECHB; MTPB; MSTP029; TP-BETA
Synonyms
HADHB; HADHB cDNA Clone; HADHB cdna clone
Ordering
For Research Use Only!
Sequence
atgactactatcttgacttacccctttaaaaatcttcccactgcatcaaaatgggccctcagattttccataagacctctgagctgttcctcccagctacgagctgccccagctgtccagaccaaaacgaagaagacgttagccaaacccaatataaggaatgttgtggtggtggatggtgttcgcactccatttttgctgtctggcacttcatataaagacctgatgccacatgatttggctagagcagcgcttacgggtttgttgcatcggaccagtgtccctaaggaagtagttgattatatcatctttggtacagttattcaggaagtgaaaacaagcaatgtggctagagaggctgcccttggagctggcttctctgacaagactcctgctcacactgtcaccatggcttgtatctctgccaaccaagccatgaccacaggtgttggcttgattgcttctggccagtgtgatgtgatcgtggcaggtggtgttgagttgatgtccgatgtccctattcgtcactcaaggaaaatgagaaaactgatgcttgatctcaataaggccaaatctatgggccagcgactgtctttaatctctaaattccgatttaatttcctagcacctgagctccctgcggtttctgagttctccaccagtgagaccatgggccactctgcagaccgactggccgctgcctttgctgtttctcggctggaacaggatgaatatgcactgcgctctcacagtctagccaagaaggcacaggatgaaggactcctttctgatgtggtacccttcaaagtaccaggaaaagatacagttaccaaagataatggcatccgtccttcctcactggagcagatggccaaactaaaacctgcattcatcaagccctacggcacagtgacagctgcaaattcttctttcttgactgatggtgcatctgcaatgttaatcatggcggaggaaaaggctctggccatgggttataagccgaaggcatatttgagggattttatgtatgtgtctcaggatccaaaagatcaactattacttggaccaacatatgctactccaaaagttctagaaaaggcaggattgaccatgaatgatattgatgcttttgaatttcatgaagctttctcgggtcagattttggcaaattttaaagccatggattctgattggtttgcagaaaactacatgggtagaaaaaccaaggttggattgcctcctttggagaagtttaataactggggtggatctctgtccctgggacacccatttggagccactggctgcaggttggtcatggctgctgccaacagattacggaaagaaggaggccagtatggcttagtggctgcgtgtgcagctggagggcagggccatgctatgatagtggaagcttatccaaaataa
Sequence Length
1428
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,880 Da
NCBI Official Full Name
Homo sapiens hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit, mRNA
NCBI Official Synonym Full Names
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit
NCBI Official Symbol
HADHB
NCBI Official Synonym Symbols
ECHB; MTPB; MSTP029; TP-BETA
NCBI Protein Information
trifunctional enzyme subunit beta, mitochondrial
UniProt Protein Name
Trifunctional enzyme subunit beta, mitochondrial
Protein Family
UniProt Gene Name
HADHB
UniProt Entry Name
ECHB_HUMAN

NCBI Description

This gene encodes the beta subunit of the mitochondrial trifunctional protein, which catalyzes the last three steps of mitochondrial beta-oxidation of long chain fatty acids. The mitochondrial membrane-bound heterocomplex is composed of four alpha and four beta subunits, with the beta subunit catalyzing the 3-ketoacyl-CoA thiolase activity. The encoded protein can also bind RNA and decreases the stability of some mRNAs. The genes of the alpha and beta subunits of the mitochondrial trifunctional protein are located adjacent to each other in the human genome in a head-to-head orientation. Mutations in this gene result in trifunctional protein deficiency. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

Uniprot Description

HADHB: Defects in HADHB are a cause of trifunctional protein deficiency (TFP deficiency). The clinical manifestations are very variable and include hypoglycemia, cardiomyopathy and sudden death. Phenotypes with mainly hepatic and neuromyopathic involvement can also be distinguished. Biochemically, TFP deficiency is defined by the loss of all three enzyme activities of the TFP complex. Belongs to the thiolase family.

Protein type: EC 2.3.1.16; Lipid Metabolism - fatty acid elongation in mitochondria; Amino Acid Metabolism - valine, leucine and isoleucine degradation; Transferase; Lipid Metabolism - fatty acid

Chromosomal Location of Human Ortholog: 2p23

Cellular Component: endoplasmic reticulum; mitochondrial envelope; mitochondrial inner membrane; mitochondrial outer membrane

Molecular Function: 3-hydroxyacyl-CoA dehydrogenase activity; enoyl-CoA hydratase activity; protein binding

Biological Process: fatty acid beta-oxidation

Disease: Trifunctional Protein Deficiency

Research Articles on HADHB

Similar Products

Product Notes

The HADHB hadhb (Catalog #AAA1275966) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactacta tcttgactta cccctttaaa aatcttccca ctgcatcaaa atgggccctc agattttcca taagacctct gagctgttcc tcccagctac gagctgcccc agctgtccag accaaaacga agaagacgtt agccaaaccc aatataagga atgttgtggt ggtggatggt gttcgcactc catttttgct gtctggcact tcatataaag acctgatgcc acatgatttg gctagagcag cgcttacggg tttgttgcat cggaccagtg tccctaagga agtagttgat tatatcatct ttggtacagt tattcaggaa gtgaaaacaa gcaatgtggc tagagaggct gcccttggag ctggcttctc tgacaagact cctgctcaca ctgtcaccat ggcttgtatc tctgccaacc aagccatgac cacaggtgtt ggcttgattg cttctggcca gtgtgatgtg atcgtggcag gtggtgttga gttgatgtcc gatgtcccta ttcgtcactc aaggaaaatg agaaaactga tgcttgatct caataaggcc aaatctatgg gccagcgact gtctttaatc tctaaattcc gatttaattt cctagcacct gagctccctg cggtttctga gttctccacc agtgagacca tgggccactc tgcagaccga ctggccgctg cctttgctgt ttctcggctg gaacaggatg aatatgcact gcgctctcac agtctagcca agaaggcaca ggatgaagga ctcctttctg atgtggtacc cttcaaagta ccaggaaaag atacagttac caaagataat ggcatccgtc cttcctcact ggagcagatg gccaaactaa aacctgcatt catcaagccc tacggcacag tgacagctgc aaattcttct ttcttgactg atggtgcatc tgcaatgtta atcatggcgg aggaaaaggc tctggccatg ggttataagc cgaaggcata tttgagggat tttatgtatg tgtctcagga tccaaaagat caactattac ttggaccaac atatgctact ccaaaagttc tagaaaaggc aggattgacc atgaatgata ttgatgcttt tgaatttcat gaagctttct cgggtcagat tttggcaaat tttaaagcca tggattctga ttggtttgca gaaaactaca tgggtagaaa aaccaaggtt ggattgcctc ctttggagaa gtttaataac tggggtggat ctctgtccct gggacaccca tttggagcca ctggctgcag gttggtcatg gctgctgcca acagattacg gaaagaagga ggccagtatg gcttagtggc tgcgtgtgca gctggagggc agggccatgc tatgatagtg gaagcttatc caaaataa. It is sometimes possible for the material contained within the vial of "HADHB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.