H6PD cdna clone
H6PD cDNA Clone
Gene Names
H6PD; GDH; G6PDH; CORTRD1
Synonyms
H6PD; H6PD cDNA Clone; H6PD cdna clone
Sequence
atgtggaatatgctcatagtggcgatgtgcttggcccttctgggctgcctgcaagcccaggagctccagggacatgtctccataatcctgctgggagcaactggggacctggctaagaagtacttatggcagggactgttccagctgtacctggatgaagcggggaggggtcacagttttagcttccatggagctgctctgacagcccccaagcagggtcaagagctcatggccaaggccctggaatccctctcctgccccaaggacatggcacccagtcactgtgcagagcacaaggatcagttcctgcagctgagccagtaccgccaactgaagacggccgaggactatcaggccctgaacaaggacatcgaggcacagctccagcacgcaggcctccgggaggctggcaggatcttctacttctcagtgccacccttcgcctatgaagacattgcccgcaacatcaacagtagctgccggccaggcccgggcgcctggctgcgggttgtccttgagaaaccctttggccatgaccacttctcagcccagcagctggccacagaactcgggacctttttccaggaggaggagatgtaccgggtggaccattacttaggcaagcaggctgtggcacagatcctgcctttccgagaccagaaccgcaaggctttggacggcctctggaaccggcaccatgtggagcgggtggagatcatcatgaaagagaccgtggatgccgaaggccgcaccagcttctatgaggagtacggtgtcattcgcgacgtcctccagaaccatctgacggaggtcctcaccctcgtggccatggagctgccccacaatgtcagcagtgcggaggctgtgctgcggcacaagcttcaggtcttccaggcgctgcggggcctgcagaggggcagtgccgtcgtgggccagtaccagtcttacagtgagcaggtgcgcagagagctgcagaagccagacagcttccacagcctgacgccgaccttcgcagccgtcctagtgcacattgacaaccttcgctgggagggcgtgcctttcatcctgatgtctggcaaagccttggacgagagagtgggctacgctcggatcttgttcaagaaccaggcctgctgtgtgcagagcgaaaagcactgggccgcggcgcagagccagtgcctgccccggcagctcgtcttccacatcggccatggcgacctgggcagccctgccgtgctggtcagcaggaacctgttcaggccctccctgccctccagctggaaggaaatggagggaccacctgggctccgccttttcggcagccctctgtccgattactacgcctacagccctgtgcaggagcgggacgcccactccgtcctcttatcccatatcttccatggccggaagaatttcttcatcaccacagagaacttgctggcctcctggaacttctggacccctctgctggagagcctggcccataaggccccacgcctctaccctggaggagctgagaatggccgtctgttggactttgagttcagtagcggccggttgttcttttcccagcagcagccggagcagctggtgccagggccagggccggccccaatgcccagtgacttccaggtcctcagggccaagtaccgagagagcccgctggtctccgcctggtccgaggagctgatctctaagctggctaatgacatcgaggccaccgctgtgcgagccgtgcggcgctttggccagttccacctggcactgtcggggggctcgagccccgtggccctgttccagcagctggccacggcgcactatggcttcccctgggcccacacgcacctgtggctggttgacgagcgctgcgtcccactctcagacccggagtccaacttccagggcctgcaggcccacctgctgcagcacgtccggatcccctactacaacatccaccccatgcctgtgcacctgcagcagcggctctgcgccgaggaggaccagggcgcccagatctatgccagggagatctcagccctggtggccaacagcagcttcgacctggtgctgctgggcatgggtgccgacgggcacacagcctccctcttcccacagtcacccactggcctggatggcgagcagctggtcgtgctgaccacgagcccctcccagccacaccgccgcatgagccttagcctgcctctcatcaaccgcgccaagaaggtggcagtcctggtcatgggcaggatgaagcgtgagatcaccacgctggtgagccgggtgggccatgagcccaagaagtggcccatctcgggtgtcctgccgcactccggccagctggtgtggtacatggactacgacgccttcctgggatga
Sequence Length
2376
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
88,893 Da
NCBI Official Full Name
Homo sapiens hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase), mRNA
NCBI Official Synonym Full Names
hexose-6-phosphate dehydrogenase/glucose 1-dehydrogenase
NCBI Official Symbol
H6PD
NCBI Official Synonym Symbols
GDH; G6PDH; CORTRD1
NCBI Protein Information
GDH/6PGL endoplasmic bifunctional protein
UniProt Protein Name
GDH/6PGL endoplasmic bifunctional protein
Protein Family
UniProt Gene Name
H6PD
UniProt Synonym Gene Names
GDH; 6PGL
UniProt Entry Name
G6PE_HUMAN
NCBI Description
There are 2 forms of glucose-6-phosphate dehydrogenase. G form is X-linked and H form, encoded by this gene, is autosomally linked. This H form shows activity with other hexose-6-phosphates, especially galactose-6-phosphate, whereas the G form is specific for glucose-6-phosphate. Both forms are present in most tissues, but H form is not found in red cells. [provided by RefSeq, Jul 2008]
Uniprot Description
H6PD: Oxidizes glucose-6-phosphate and glucose, as well as other hexose-6-phosphates. Defects in H6PD are a cause of cortisone reductase deficiency (CRD). In CRD, activation of cortisone to cortisol does not occur, resulting in adrenocorticotropin-mediated androgen excess and a phenotype resembling polycystic ovary syndrome (PCOS).
Protein type: EC 1.1.1.47; Hydrolase; EC 3.1.1.31; Oxidoreductase; Carbohydrate Metabolism - pentose phosphate pathway
Chromosomal Location of Human Ortholog: 1p36
Disease: Cortisone Reductase Deficiency 1
Research Articles on H6PD
Similar Products
Product Notes
The H6PD h6pd (Catalog #AAA1266732) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggaata tgctcatagt ggcgatgtgc ttggcccttc tgggctgcct gcaagcccag gagctccagg gacatgtctc cataatcctg ctgggagcaa ctggggacct ggctaagaag tacttatggc agggactgtt ccagctgtac ctggatgaag cggggagggg tcacagtttt agcttccatg gagctgctct gacagccccc aagcagggtc aagagctcat ggccaaggcc ctggaatccc tctcctgccc caaggacatg gcacccagtc actgtgcaga gcacaaggat cagttcctgc agctgagcca gtaccgccaa ctgaagacgg ccgaggacta tcaggccctg aacaaggaca tcgaggcaca gctccagcac gcaggcctcc gggaggctgg caggatcttc tacttctcag tgccaccctt cgcctatgaa gacattgccc gcaacatcaa cagtagctgc cggccaggcc cgggcgcctg gctgcgggtt gtccttgaga aaccctttgg ccatgaccac ttctcagccc agcagctggc cacagaactc gggacctttt tccaggagga ggagatgtac cgggtggacc attacttagg caagcaggct gtggcacaga tcctgccttt ccgagaccag aaccgcaagg ctttggacgg cctctggaac cggcaccatg tggagcgggt ggagatcatc atgaaagaga ccgtggatgc cgaaggccgc accagcttct atgaggagta cggtgtcatt cgcgacgtcc tccagaacca tctgacggag gtcctcaccc tcgtggccat ggagctgccc cacaatgtca gcagtgcgga ggctgtgctg cggcacaagc ttcaggtctt ccaggcgctg cggggcctgc agaggggcag tgccgtcgtg ggccagtacc agtcttacag tgagcaggtg cgcagagagc tgcagaagcc agacagcttc cacagcctga cgccgacctt cgcagccgtc ctagtgcaca ttgacaacct tcgctgggag ggcgtgcctt tcatcctgat gtctggcaaa gccttggacg agagagtggg ctacgctcgg atcttgttca agaaccaggc ctgctgtgtg cagagcgaaa agcactgggc cgcggcgcag agccagtgcc tgccccggca gctcgtcttc cacatcggcc atggcgacct gggcagccct gccgtgctgg tcagcaggaa cctgttcagg ccctccctgc cctccagctg gaaggaaatg gagggaccac ctgggctccg ccttttcggc agccctctgt ccgattacta cgcctacagc cctgtgcagg agcgggacgc ccactccgtc ctcttatccc atatcttcca tggccggaag aatttcttca tcaccacaga gaacttgctg gcctcctgga acttctggac ccctctgctg gagagcctgg cccataaggc cccacgcctc taccctggag gagctgagaa tggccgtctg ttggactttg agttcagtag cggccggttg ttcttttccc agcagcagcc ggagcagctg gtgccagggc cagggccggc cccaatgccc agtgacttcc aggtcctcag ggccaagtac cgagagagcc cgctggtctc cgcctggtcc gaggagctga tctctaagct ggctaatgac atcgaggcca ccgctgtgcg agccgtgcgg cgctttggcc agttccacct ggcactgtcg gggggctcga gccccgtggc cctgttccag cagctggcca cggcgcacta tggcttcccc tgggcccaca cgcacctgtg gctggttgac gagcgctgcg tcccactctc agacccggag tccaacttcc agggcctgca ggcccacctg ctgcagcacg tccggatccc ctactacaac atccacccca tgcctgtgca cctgcagcag cggctctgcg ccgaggagga ccagggcgcc cagatctatg ccagggagat ctcagccctg gtggccaaca gcagcttcga cctggtgctg ctgggcatgg gtgccgacgg gcacacagcc tccctcttcc cacagtcacc cactggcctg gatggcgagc agctggtcgt gctgaccacg agcccctccc agccacaccg ccgcatgagc cttagcctgc ctctcatcaa ccgcgccaag aaggtggcag tcctggtcat gggcaggatg aagcgtgaga tcaccacgct ggtgagccgg gtgggccatg agcccaagaa gtggcccatc tcgggtgtcc tgccgcactc cggccagctg gtgtggtaca tggactacga cgccttcctg ggatga. It is sometimes possible for the material contained within the vial of "H6PD, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
