Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

H2AFY2 cdna clone

H2AFY2 cDNA Clone

Gene Names
H2AFY2; macroH2A2
Synonyms
H2AFY2; H2AFY2 cDNA Clone; H2AFY2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgggccggagtgggaagaagaaaatgtccaagctgtcccgttcagctagggcaggtgtcatctttccagtggggaggctgatgcgttatctgaagaaagggacgttcaagtaccggatcagcgtgggcgcccctgtctacatggcggcagtcattgagtacctggcagcggaaattctagaattggccggcaatgccgcgagggacaacaagaaggcccggatagccccgagacacatcttgctggcagttgccaatgacgaggagctcaaccagctgctaaaaggagtgaccatcgccagtggaggcgtcctgcccagaattcaccccgaactgctggccaaaaagcgagggaccaaaggcaagtcggaaacgatcctctccccacccccagagaaaagaggcaggaaggccacgtcaggcaagaagggggggaagaaatccaaggctgccaaaccacggacgtccaaaaagtccaaaccaaaggacagcgataaagaaggaacttcaaattccacctctgaagatgggccaggggatggattcaccattctgtcttctaagagccttgttctgggacagaagctgtccttaacccagagtgacatcagccatattggctccatgagagtggagggcattgtccacccaaccacagccgaaattgacctcaaagaagatataggtaaagccttggaaaaggctgggggaaaagagttcttggaaacggtaaaggagcttcgcaaatcccaaggccctttggaagtcgccgaagccgccgtcagccaatccagtggactcgcagccaaatttgtcatccactgtcacatccctcagtggggctccgacaaatgtgaagaacagcttgaagagaccatcaaaaactgcctgtcagcggcggaggacaagaagctaaagtccgtcgcgttcccgcctttccccagcggcagaaactgctttcccaaacagactgcggcccaggtgaccctcaaagccatctcagcccactttgatgactcgagcgcgtcctcgctgaagaacgtgtacttcctgctcttcgacagcgagagcatcggcatctacgtgcaggagatggccaagctcgacgccaagtag
Sequence Length
1119
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,058 Da
NCBI Official Full Name
Homo sapiens H2A histone family, member Y2, mRNA
NCBI Official Synonym Full Names
H2A histone family member Y2
NCBI Official Symbol
H2AFY2
NCBI Official Synonym Symbols
macroH2A2
NCBI Protein Information
core histone macro-H2A.2
UniProt Protein Name
Core histone macro-H2A.2
Protein Family
UniProt Gene Name
H2AFY2
UniProt Synonym Gene Names
MACROH2A2; Histone macroH2A2; mH2A2
UniProt Entry Name
H2AW_HUMAN

NCBI Description

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. It replaces conventional H2A histones in a subset of nucleosomes where it represses transcription and may participate in stable X chromosome inactivation. [provided by RefSeq, Oct 2015]

Uniprot Description

H2AFY2: Variant histone H2A which replaces conventional H2A in a subset of nucleosomes where it represses transcription. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post- translational modifications of histones, also called histone code, and nucleosome remodeling. May be involved in stable X chromosome inactivation.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 10q22.1

Cellular Component: Barr body; ESC/E(Z) complex; nuclear chromatin; nuclear chromosome, telomeric region; nucleoplasm

Molecular Function: chromatin DNA binding

Biological Process: brain development; chromatin silencing; dosage compensation; negative regulation of gene expression, epigenetic; negative regulation of transcription from RNA polymerase II promoter; positive regulation of keratinocyte differentiation; regulation of cell growth

Research Articles on H2AFY2

Similar Products

Product Notes

The H2AFY2 h2afy2 (Catalog #AAA1272008) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgggcc ggagtgggaa gaagaaaatg tccaagctgt cccgttcagc tagggcaggt gtcatctttc cagtggggag gctgatgcgt tatctgaaga aagggacgtt caagtaccgg atcagcgtgg gcgcccctgt ctacatggcg gcagtcattg agtacctggc agcggaaatt ctagaattgg ccggcaatgc cgcgagggac aacaagaagg cccggatagc cccgagacac atcttgctgg cagttgccaa tgacgaggag ctcaaccagc tgctaaaagg agtgaccatc gccagtggag gcgtcctgcc cagaattcac cccgaactgc tggccaaaaa gcgagggacc aaaggcaagt cggaaacgat cctctcccca cccccagaga aaagaggcag gaaggccacg tcaggcaaga agggggggaa gaaatccaag gctgccaaac cacggacgtc caaaaagtcc aaaccaaagg acagcgataa agaaggaact tcaaattcca cctctgaaga tgggccaggg gatggattca ccattctgtc ttctaagagc cttgttctgg gacagaagct gtccttaacc cagagtgaca tcagccatat tggctccatg agagtggagg gcattgtcca cccaaccaca gccgaaattg acctcaaaga agatataggt aaagccttgg aaaaggctgg gggaaaagag ttcttggaaa cggtaaagga gcttcgcaaa tcccaaggcc ctttggaagt cgccgaagcc gccgtcagcc aatccagtgg actcgcagcc aaatttgtca tccactgtca catccctcag tggggctccg acaaatgtga agaacagctt gaagagacca tcaaaaactg cctgtcagcg gcggaggaca agaagctaaa gtccgtcgcg ttcccgcctt tccccagcgg cagaaactgc tttcccaaac agactgcggc ccaggtgacc ctcaaagcca tctcagccca ctttgatgac tcgagcgcgt cctcgctgaa gaacgtgtac ttcctgctct tcgacagcga gagcatcggc atctacgtgc aggagatggc caagctcgac gccaagtag. It is sometimes possible for the material contained within the vial of "H2AFY2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.