Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

H2AFY cdna clone

H2AFY cDNA Clone

Gene Names
H2AFY; H2A.y; H2A/y; mH2A1; H2AF12M; MACROH2A1.1; macroH2A1.2
Synonyms
H2AFY; H2AFY cDNA Clone; H2AFY cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgagccgcggtgggaagaagaagtccaccaagacgtccaggtctgccaaagcaggagtcatctttcccgtggggcggatgctgcggtacatcaagaaaggccaccccaagtacaggattggagtgggggcacccgtgtacatggccgccgtcctggaatacctgacagcggagattctggagctggctggcaatgcagcgagagacaacaagaagggacgggtcacaccccggcacatcctgctggctgtggccaatgatgaagagctgaatcagctgctaaaaggagtcaccatagccagtgggggtgtgttacccaacatccaccccgagttgctagcgaagaagcggggatccaaaggaaagttggaagccatcatcacaccacccccagccaaaaaggccaagtctccatcccagaagaagcctgtatctaaaaaagcaggaggcaagaaaggggcccggaaatccaagaagaagcagggtgaagtcagtaaggcagccagcgccgacagcacaaccgagggcacacctgccgacggcttcacagtcctctccaccaagagcctcttccttggccagaagctgaaccttattcacagtgaaatcagtaatttagccggctttgaggtggaggccataatcaatcctaccaatgctgacattgaccttaaagatgacctaggaaacacgctggagaagaaaggtggcaaggagtttgtggaagctgtcctggaactccggaaaaagaacgggcccttggaagtagctggagctgctgtcagcgcaggccatggcctgcctgccaagtttgtgatccactgtaatagtccagtttggggtgcagacaagtgtgaagaacttctggaaaagacagtgaaaaactgcttggccctggctgatgataagaagctgaaatccattgcatttccatccatcggcagcggcaggaacggttttccaaagcagacagcagctcagctgattctgaaggccatctccagttacttcgtgtctacaatgtcctcttccatcaaaacggtgtacttcgtgctttttgacagcgagagtataggcatctatgtgcaggaaatggccaagctggacgccaactag
Sequence Length
1119
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,489 Da
NCBI Official Full Name
Homo sapiens H2A histone family, member Y, mRNA
NCBI Official Synonym Full Names
H2A histone family member Y
NCBI Official Symbol
H2AFY
NCBI Official Synonym Symbols
H2A.y; H2A/y; mH2A1; H2AF12M; MACROH2A1.1; macroH2A1.2
NCBI Protein Information
core histone macro-H2A.1
UniProt Protein Name
Core histone macro-H2A.1
Protein Family
UniProt Gene Name
H2AFY
UniProt Synonym Gene Names
MACROH2A1; Histone macroH2A1; mH2A1; H2A/y
UniProt Entry Name
H2AY_HUMAN

NCBI Description

Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent histone that is a member of the histone H2A family. It replaces conventional H2A histones in a subset of nucleosomes where it represses transcription and participates in stable X chromosome inactivation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

Uniprot Description

H2AFY: Variant histone H2A which replaces conventional H2A in a subset of nucleosomes where it represses transcription. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post- translational modifications of histones, also called histone code, and nucleosome remodeling. Involved in stable X chromosome inactivation. Inhibits the binding of transcription factors and interferes with the activity of remodeling SWI/SNF complexes. Inhibits histone acetylation by EP300 and recruits class I HDACs, which induces an hypoacetylated state of chromatin. In addition, isoform 1, but not isoform 2, binds ADP-ribose and O-acetyl-ADP- ribose, and may be involved in ADP-ribose-mediated chromatin modulation. The nucleosome is a histone octamer containing two molecules each of H2A, H2B, H3 and H4 assembled in one H3-H4 heterotetramer and two H2A-H2B heterodimers. Interacts with SPOP. Part of a complex consisting of H2AFY, CUL3 and SPOP. Interacts with HDAC1 and HDAC2. Ubiquitous. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 5q31.1

Cellular Component: Barr body; centric heterochromatin; ESC/E(Z) complex; nuclear chromatin; nuclear chromosome; nuclear chromosome, telomeric region; nucleolus; nucleus; sex chromatin

Molecular Function: chromatin DNA binding; double-stranded methylated DNA binding; enzyme binding; nucleosomal DNA binding; protein binding; protein kinase binding; protein serine/threonine kinase inhibitor activity; rDNA binding

Biological Process: chromatin silencing; dosage compensation; negative regulation of gene expression, epigenetic; negative regulation of histone H3-K4 methylation; negative regulation of histone phosphorylation; negative regulation of transcription from RNA polymerase II promoter; positive regulation of gene expression, epigenetic; positive regulation of keratinocyte differentiation; positive regulation of maintenance of mitotic sister chromatid cohesion; regulation of cell growth; regulation of gene expression, epigenetic; regulation of lipid metabolic process

Research Articles on H2AFY

Similar Products

Product Notes

The H2AFY h2afy (Catalog #AAA1271010) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgagcc gcggtgggaa gaagaagtcc accaagacgt ccaggtctgc caaagcagga gtcatctttc ccgtggggcg gatgctgcgg tacatcaaga aaggccaccc caagtacagg attggagtgg gggcacccgt gtacatggcc gccgtcctgg aatacctgac agcggagatt ctggagctgg ctggcaatgc agcgagagac aacaagaagg gacgggtcac accccggcac atcctgctgg ctgtggccaa tgatgaagag ctgaatcagc tgctaaaagg agtcaccata gccagtgggg gtgtgttacc caacatccac cccgagttgc tagcgaagaa gcggggatcc aaaggaaagt tggaagccat catcacacca cccccagcca aaaaggccaa gtctccatcc cagaagaagc ctgtatctaa aaaagcagga ggcaagaaag gggcccggaa atccaagaag aagcagggtg aagtcagtaa ggcagccagc gccgacagca caaccgaggg cacacctgcc gacggcttca cagtcctctc caccaagagc ctcttccttg gccagaagct gaaccttatt cacagtgaaa tcagtaattt agccggcttt gaggtggagg ccataatcaa tcctaccaat gctgacattg accttaaaga tgacctagga aacacgctgg agaagaaagg tggcaaggag tttgtggaag ctgtcctgga actccggaaa aagaacgggc ccttggaagt agctggagct gctgtcagcg caggccatgg cctgcctgcc aagtttgtga tccactgtaa tagtccagtt tggggtgcag acaagtgtga agaacttctg gaaaagacag tgaaaaactg cttggccctg gctgatgata agaagctgaa atccattgca tttccatcca tcggcagcgg caggaacggt tttccaaagc agacagcagc tcagctgatt ctgaaggcca tctccagtta cttcgtgtct acaatgtcct cttccatcaa aacggtgtac ttcgtgcttt ttgacagcga gagtataggc atctatgtgc aggaaatggc caagctggac gccaactag. It is sometimes possible for the material contained within the vial of "H2AFY, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.