Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GZMB cdna clone

GZMB cDNA Clone

Gene Names
GZMB; HLP; CCPI; CGL1; CSPB; SECT; CGL-1; CSP-B; CTLA1; CTSGL1
Synonyms
GZMB; GZMB cDNA Clone; GZMB cdna clone
Ordering
For Research Use Only!
Sequence
atgcaaccaatcctgcttctgctggccttcctcctgctgcccagggcagatgcaggggagatcatcgggggacatgaggccaagccccactcccgcccctacatggcttatcttatgatctgggatcagaagtctctgaagaggtgcggtggcttcctgatacaagacgacttcgtgctgacagctgctcactgttggggaagctccataaatgtcaccttgggggcccacaatatcaaagaacaggagccgacccagcagtttatccctgtgaaaagacccatcccccatccagcctataatcctaagaacttctccaacgacatcatgctactgcagctggagagaaaggccaagcggaccagagctgtgcagcccctcaggctacctagcaacaaggcccaggtgaagccagggcagacatgcagtgtggccggctgggggcagacggcccccctgggaaaacactcacacacactacaagaggtgaagatgacagtgcaggaagatcgaaagtgcgaatctgacttacgccattattacgacagtaccattgagttgtgcgtgggggacccagagattaaaaagacttcctttaagggggactctggaggccctcttgtgtgtaacaaggtggcccagggcattgtctcctatggacgaaacaatggcatgcctccacgagcctgcaccaaagtctcaagctttgtacactggataaagaaaaccatgaaacgccactaa
Sequence Length
744
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,716 Da
NCBI Official Full Name
Homo sapiens granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1), mRNA
NCBI Official Synonym Full Names
granzyme B
NCBI Official Symbol
GZMB
NCBI Official Synonym Symbols
HLP; CCPI; CGL1; CSPB; SECT; CGL-1; CSP-B; CTLA1; CTSGL1
NCBI Protein Information
granzyme B
UniProt Protein Name
Granzyme B
Protein Family
UniProt Gene Name
GZMB
UniProt Synonym Gene Names
CGL1; CSPB; CTLA1; GRB; CTSGL1; Lymphocyte protease; HLP
UniProt Entry Name
GRAB_HUMAN

NCBI Description

Cytolytic T lymphocytes (CTL) and natural killer (NK) cells share the remarkable ability to recognize, bind, and lyse specific target cells. They are thought to protect their host by lysing cells bearing on their surface 'nonself' antigens, usually peptides or proteins resulting from infection by intracellular pathogens. The protein encoded by this gene is crucial for the rapid induction of target cell apoptosis by CTL in cell-mediated immune response. [provided by RefSeq, Jul 2008]

Uniprot Description

GZMB: This enzyme is necessary for target cell lysis in cell- mediated immune responses. It cleaves after Asp. Seems to be linked to an activation cascade of caspases (aspartate-specific cysteine proteases) responsible for apoptosis execution. Cleaves caspase-3, -7, -9 and 10 to give rise to active enzymes mediating apoptosis. By staphylococcal enterotoxin A (SEA) in peripheral blood leukocytes. Inactivated by the serine protease inhibitor diisopropylfluorophosphate. Belongs to the peptidase S1 family. Granzyme subfamily.

Protein type: EC 3.4.21.79; Apoptosis; Protease

Chromosomal Location of Human Ortholog: 14q11.2

Cellular Component: cytoplasm; cytosol; immunological synapse; intracellular membrane-bound organelle; membrane; nucleus

Molecular Function: protein binding; serine-type endopeptidase activity; serine-type peptidase activity

Biological Process: apoptosis; natural killer cell mediated cytotoxicity; protein processing

Research Articles on GZMB

Similar Products

Product Notes

The GZMB gzmb (Catalog #AAA1273885) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaaccaa tcctgcttct gctggccttc ctcctgctgc ccagggcaga tgcaggggag atcatcgggg gacatgaggc caagccccac tcccgcccct acatggctta tcttatgatc tgggatcaga agtctctgaa gaggtgcggt ggcttcctga tacaagacga cttcgtgctg acagctgctc actgttgggg aagctccata aatgtcacct tgggggccca caatatcaaa gaacaggagc cgacccagca gtttatccct gtgaaaagac ccatccccca tccagcctat aatcctaaga acttctccaa cgacatcatg ctactgcagc tggagagaaa ggccaagcgg accagagctg tgcagcccct caggctacct agcaacaagg cccaggtgaa gccagggcag acatgcagtg tggccggctg ggggcagacg gcccccctgg gaaaacactc acacacacta caagaggtga agatgacagt gcaggaagat cgaaagtgcg aatctgactt acgccattat tacgacagta ccattgagtt gtgcgtgggg gacccagaga ttaaaaagac ttcctttaag ggggactctg gaggccctct tgtgtgtaac aaggtggccc agggcattgt ctcctatgga cgaaacaatg gcatgcctcc acgagcctgc accaaagtct caagctttgt acactggata aagaaaacca tgaaacgcca ctaa. It is sometimes possible for the material contained within the vial of "GZMB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.