Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GYPC cdna clone

GYPC cDNA Clone

Gene Names
GYPC; GE; GPC; GPD; GYPD; CD236; PAS-2; CD236R; PAS-2'
Synonyms
GYPC; GYPC cDNA Clone; GYPC cdna clone
Ordering
For Research Use Only!
Sequence
ATGTGGTCGACGAGAAGCCCCAACAGCACGGCGTGGCCTCTCAGCCTCGAGCCTGATCCGGGGATGGCCTCTGCCTCCACCACAATGCATACTACCACCATTGCAGAGCCTGATCCAGGGATGTCTGGATGGCCGGATGGCAGAATGGAGACCTCCACCCCCACCATAATGGACATTGTCGTCATTGCAGGTGTGATTGCTGCTGTGGCCATCGTCCTAGTCTCCCTCCTCTTCGTCATGCTGCGCTACATGTACCGGCACAAGGGCACGTACCACACCAATGAGGCCAAGGGCACGGAGTTTGCTGAGAGTGCAGATGCAGCCCTGCAGGGCGACCCTGCCCTCCAAGATGCTGGTGATAGCAGCAGAAAGGAGTACTTTATTTGA
Sequence Length
387
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GeneID
Molecular Weight
11,910 Da
NCBI Official Synonym Full Names
glycophorin C (Gerbich blood group)
NCBI Official Symbol
GYPC
NCBI Official Synonym Symbols
GE; GPC; GPD; GYPD; CD236; PAS-2; CD236R; PAS-2'
NCBI Protein Information
glycophorin-C
UniProt Protein Name
Glycophorin-C
Protein Family
UniProt Gene Name
GYPC
UniProt Synonym Gene Names
GLPC; GPC; GPD
UniProt Entry Name
GLPC_HUMAN

NCBI Description

Glycophorin C (GYPC) is an integral membrane glycoprotein. It is a minor species carried by human erythrocytes, but plays an important role in regulating the mechanical stability of red cells. A number of glycophorin C mutations have been described. The Gerbich and Yus phenotypes are due to deletion of exon 3 and 2, respectively. The Webb and Duch antigens, also known as glycophorin D, result from single point mutations of the glycophorin C gene. The glycophorin C protein has very little homology with glycophorins A and B. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]

Uniprot Description

GYPC: This protein is a minor sialoglycoprotein in human erythrocyte membranes. The blood group Gerbich antigens and receptors for Plasmodium falciparum merozoites are most likely located within the extracellular domain. Glycophorin-C plays an important role in regulating the stability of red cells. Belongs to the glycophorin-C family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 2q14-q21

Cellular Component: cortical cytoskeleton; integral to plasma membrane; membrane

Molecular Function: protein binding

Disease: Blood Group, Gerbich System; Malaria, Susceptibility To

Research Articles on GYPC

Similar Products

Product Notes

The GYPC gypc (Catalog #AAA1269892) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGTGGTCGA CGAGAAGCCC CAACAGCACG GCGTGGCCTC TCAGCCTCGA GCCTGATCCG GGGATGGCCT CTGCCTCCAC CACAATGCAT ACTACCACCA TTGCAGAGCC TGATCCAGGG ATGTCTGGAT GGCCGGATGG CAGAATGGAG ACCTCCACCC CCACCATAAT GGACATTGTC GTCATTGCAG GTGTGATTGC TGCTGTGGCC ATCGTCCTAG TCTCCCTCCT CTTCGTCATG CTGCGCTACA TGTACCGGCA CAAGGGCACG TACCACACCA ATGAGGCCAA GGGCACGGAG TTTGCTGAGA GTGCAGATGC AGCCCTGCAG GGCGACCCTG CCCTCCAAGA TGCTGGTGAT AGCAGCAGAA AGGAGTACTT TATTTGA. It is sometimes possible for the material contained within the vial of "GYPC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.