GTPBP5 cdna clone
GTPBP5 cDNA Clone
Gene Names
MTG2; ObgH1; GTPBP5; dJ1005F21.2
Synonyms
GTPBP5; GTPBP5 cDNA Clone; GTPBP5 cdna clone
Sequence
atggcacctgcaaggtgtttttcagcaagattgaggaccgtgtttcagggcgtggggcattgggctttgtccacatgggctggcctgaagcccagccggctactgccacagcgggcttctcccaggctgctctcggtcggccgtgcggacctcgccaagcatcaggaactcccggggaagaagctgctctctgagaaaaagctgaaaaggtactttgtggactatcggagagtgcttgtctgtggaggaaacggaggcgctggggcaagctgcttccacagtgagccccgcaaggagtttggaggccctgatggaggggacggaggcaacggtggacacgtcattctgagagttgaccagcaagtcaagtccctgtcgtcggtcctgtcgcggtaccagggtttcagtggagaagatggagggagtaaaaactgcttcgggcgcagtggcgccgtcctctacatccgggtccccgtgggcacgctggtgaaggagggaggcagagttgtggccgacctgtcttgcgtgggagatgagtacattgccgcgctgggcggggcaggagggaaaggcaaccgcttcttcctggccaacaacaaccgtgcccctgtgacctgtacccctggacagccaggacagcagcgagttctccacctggagctcaagacggtggcccacgccggaatggtgggattccccaacgccgggaagtcctcactgctccgggccatttcaaacgccagacccgccgtggcttcctacccgttcaccaccctgaagccccacgtcgggatcgtccactacgaaggccacctacaaatagcagtggccgacatccccggcatcatacgaggcgcccaccagaacaggggtctggggtccgccttcctcaggcacatcgagcgctgccgctttctcttgttcgtggtggatctttctcagcctgagccgtggactcaagttgacgatttaaaatatgaactggagatgtatgaaaagggcctgtctgcgaggccccacgcaatcgtcgcaaacaagattgacctccctgaagcccaagccaatctgtcccagctccgggatcacttgggacaggaggtcatcgtgctgtcggcgttgaccggcgagaacctggagcagctgctgttgcacctgaaggtgctgtatgacgcctacgcggaggccgagctgggccagggccgccagccgctcaggtggtag
Sequence Length
1221
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
19,820 Da
NCBI Official Full Name
Homo sapiens GTP binding protein 5 (putative), mRNA
NCBI Official Synonym Full Names
mitochondrial ribosome associated GTPase 2
NCBI Official Symbol
MTG2
NCBI Official Synonym Symbols
ObgH1; GTPBP5; dJ1005F21.2
NCBI Protein Information
mitochondrial ribosome-associated GTPase 2
UniProt Protein Name
Mitochondrial ribosome-associated GTPase 2
UniProt Gene Name
MTG2
UniProt Synonym Gene Names
GTPBP5; OBGH1; ObgH1
UniProt Entry Name
MTG2_HUMAN
NCBI Description
Small G proteins, such as GTPBP5, act as molecular switches that play crucial roles in the regulation of fundamental cellular processes such as protein synthesis, nuclear transport, membrane trafficking, and signal transduction (Hirano et al., 2006 [PubMed 17054726]).[supplied by OMIM, Mar 2008]
Uniprot Description
MTG2: Involved in the ribosome maturation process. Plays a role of GTPase in vitro. When missing, mitochondria elongation and abnormal nuclear morphology are observed. Belongs to the GTP1/OBG family.
Chromosomal Location of Human Ortholog: 20q13.33
Cellular Component: mitochondrial inner membrane; mitochondrial matrix; mitochondrial ribosome
Molecular Function: GTPase activity
Research Articles on GTPBP5
Similar Products
Product Notes
The GTPBP5 mtg2 (Catalog #AAA1265880) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcacctg caaggtgttt ttcagcaaga ttgaggaccg tgtttcaggg cgtggggcat tgggctttgt ccacatgggc tggcctgaag cccagccggc tactgccaca gcgggcttct cccaggctgc tctcggtcgg ccgtgcggac ctcgccaagc atcaggaact cccggggaag aagctgctct ctgagaaaaa gctgaaaagg tactttgtgg actatcggag agtgcttgtc tgtggaggaa acggaggcgc tggggcaagc tgcttccaca gtgagccccg caaggagttt ggaggccctg atggagggga cggaggcaac ggtggacacg tcattctgag agttgaccag caagtcaagt ccctgtcgtc ggtcctgtcg cggtaccagg gtttcagtgg agaagatgga gggagtaaaa actgcttcgg gcgcagtggc gccgtcctct acatccgggt ccccgtgggc acgctggtga aggagggagg cagagttgtg gccgacctgt cttgcgtggg agatgagtac attgccgcgc tgggcggggc aggagggaaa ggcaaccgct tcttcctggc caacaacaac cgtgcccctg tgacctgtac ccctggacag ccaggacagc agcgagttct ccacctggag ctcaagacgg tggcccacgc cggaatggtg ggattcccca acgccgggaa gtcctcactg ctccgggcca tttcaaacgc cagacccgcc gtggcttcct acccgttcac caccctgaag ccccacgtcg ggatcgtcca ctacgaaggc cacctacaaa tagcagtggc cgacatcccc ggcatcatac gaggcgccca ccagaacagg ggtctggggt ccgccttcct caggcacatc gagcgctgcc gctttctctt gttcgtggtg gatctttctc agcctgagcc gtggactcaa gttgacgatt taaaatatga actggagatg tatgaaaagg gcctgtctgc gaggccccac gcaatcgtcg caaacaagat tgacctccct gaagcccaag ccaatctgtc ccagctccgg gatcacttgg gacaggaggt catcgtgctg tcggcgttga ccggcgagaa cctggagcag ctgctgttgc acctgaaggt gctgtatgac gcctacgcgg aggccgagct gggccagggc cgccagccgc tcaggtggta g. It is sometimes possible for the material contained within the vial of "GTPBP5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
