Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GTPBP3 cdna clone

GTPBP3 cDNA Clone

Gene Names
GTPBP3; MSS1; MTGP1; THDF1; GTPBG3; COXPD23
Synonyms
GTPBP3; GTPBP3 cDNA Clone; GTPBP3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtggcgggggctttggaccctggcggcccaagcggcacgtgggcctcgcagattgtgcacgcgccggagcagcggcgcaccagcccccggctccggcgccaccatcttcgcgctaagctctggccaaggccgctgcggcatcgcagtgatccggaccagcggccccgccagcggccacgccctccgaattctcacagcaccccgagacctgccccttgctcgccacgccagcctgcgcctgctcagcgatccccgctccggggagcctctggaccgcgcactggtgctctggttcccaggtccccagagtttcaccggtgaggactgcgtggagttccacgtgcatggaggcccggcagtggtgagcggcgtcctgcaggccttgggcagcgtgccagggcttcgaccggcggaggcaggcgagttcaccagacgggcgttcgccaatgggaagctgaacctgaccgaagtggaggggctggcggaccttatccacgcggaaacagaggcgcagcggcggcaggccctcaggcagctggacggagagctgggccacctctgccgtggctgggccgagaccctcaccaaagctctggcccacgtggaggcctatatcgatttcggcgaggatgacaacctggaggagggggtcctggagcaagccgacatcgaagtacgggcactgcaggtggccctgggtgcacatctacgagatgccaggcgcgggcagaggctccgctcaggggtgcacgtagtggtcactggaccccccaatgcgggcaagagcagcctagtgaacctgctcagtcggaagcctgtgtccatcgtgtccccggagccagggaccacccgtgacgtgctggagaccccagtcgacctggccggatttcctgtgctgctgagcgacacggctgggttgcgggagggcgtggggcccgtggagcaggagggcgtgcggcgcgcccgggagaggctagagcaggctgacctcattctggccatgctggatgcttctgacctggcctctccctccagttgcaacttcctggccaccgtcgtagcctctgtgggagcccagagccccagtgacagcagccagcacctcctcctggtgctgaacaagtcggacctgctgtccccggagggcccaggtcccggtcctgacctgcccccgcacctgctgctgtcctgtctgacgggagaggggctggacggcctcctggaggcgctgaggaaggagctagctgcagtgtgtggggacccgtccacagatcccccgctgctgacccgagcaaggcaccagcaccacctccagggttgcctggatgccctcggccactacaagcagtcaaaagacctggccctggcggcagaggcgctgcgggtggcccggggtcacctgacccggctcacaggtggagggggtaccgaggagatcctggacatcatcttccaggacttctgtgtgggcaagtga
Sequence Length
1479
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,440 Da
NCBI Official Full Name
Homo sapiens GTP binding protein 3 (mitochondrial), mRNA
NCBI Official Synonym Full Names
GTP binding protein 3 (mitochondrial)
NCBI Official Symbol
GTPBP3
NCBI Official Synonym Symbols
MSS1; MTGP1; THDF1; GTPBG3; COXPD23
NCBI Protein Information
tRNA modification GTPase GTPBP3, mitochondrial
UniProt Protein Name
tRNA modification GTPase GTPBP3, mitochondrial
Protein Family
UniProt Gene Name
GTPBP3
UniProt Synonym Gene Names
MTGP1
UniProt Entry Name
GTPB3_HUMAN

NCBI Description

This locus encodes a GTP-binding protein. The encoded protein is localized to the mitochondria and may play a role in mitochondrial tRNA modification. Polymorphisms at this locus may be associated with severity of aminoglycoside-induced deafness, a disease associated with a mutation in the 12S rRNA. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Sep 2010]

Uniprot Description

GTPBP3: GTPase involved in the 5-carboxymethylaminomethyl modification (mnm(5)s(2)U34) of the wobble uridine base in mitochondrial tRNAs (Probable). Belongs to the Era/MnmE GTP-binding protein family. MnmE subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 19p13.11

Cellular Component: mitochondrion

Molecular Function: GTP binding; GTPase activity; protein binding

Biological Process: tRNA methylation; tRNA wobble uridine modification

Disease: Combined Oxidative Phosphorylation Deficiency 23

Research Articles on GTPBP3

Similar Products

Product Notes

The GTPBP3 gtpbp3 (Catalog #AAA1273932) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggcggg ggctttggac cctggcggcc caagcggcac gtgggcctcg cagattgtgc acgcgccgga gcagcggcgc accagccccc ggctccggcg ccaccatctt cgcgctaagc tctggccaag gccgctgcgg catcgcagtg atccggacca gcggccccgc cagcggccac gccctccgaa ttctcacagc accccgagac ctgccccttg ctcgccacgc cagcctgcgc ctgctcagcg atccccgctc cggggagcct ctggaccgcg cactggtgct ctggttccca ggtccccaga gtttcaccgg tgaggactgc gtggagttcc acgtgcatgg aggcccggca gtggtgagcg gcgtcctgca ggccttgggc agcgtgccag ggcttcgacc ggcggaggca ggcgagttca ccagacgggc gttcgccaat gggaagctga acctgaccga agtggagggg ctggcggacc ttatccacgc ggaaacagag gcgcagcggc ggcaggccct caggcagctg gacggagagc tgggccacct ctgccgtggc tgggccgaga ccctcaccaa agctctggcc cacgtggagg cctatatcga tttcggcgag gatgacaacc tggaggaggg ggtcctggag caagccgaca tcgaagtacg ggcactgcag gtggccctgg gtgcacatct acgagatgcc aggcgcgggc agaggctccg ctcaggggtg cacgtagtgg tcactggacc ccccaatgcg ggcaagagca gcctagtgaa cctgctcagt cggaagcctg tgtccatcgt gtccccggag ccagggacca cccgtgacgt gctggagacc ccagtcgacc tggccggatt tcctgtgctg ctgagcgaca cggctgggtt gcgggagggc gtggggcccg tggagcagga gggcgtgcgg cgcgcccggg agaggctaga gcaggctgac ctcattctgg ccatgctgga tgcttctgac ctggcctctc cctccagttg caacttcctg gccaccgtcg tagcctctgt gggagcccag agccccagtg acagcagcca gcacctcctc ctggtgctga acaagtcgga cctgctgtcc ccggagggcc caggtcccgg tcctgacctg cccccgcacc tgctgctgtc ctgtctgacg ggagaggggc tggacggcct cctggaggcg ctgaggaagg agctagctgc agtgtgtggg gacccgtcca cagatccccc gctgctgacc cgagcaaggc accagcacca cctccagggt tgcctggatg ccctcggcca ctacaagcag tcaaaagacc tggccctggc ggcagaggcg ctgcgggtgg cccggggtca cctgacccgg ctcacaggtg gagggggtac cgaggagatc ctggacatca tcttccagga cttctgtgtg ggcaagtga. It is sometimes possible for the material contained within the vial of "GTPBP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.