GTPBP10 cdna clone
GTPBP10 cDNA Clone
Gene Names
GTPBP10; ObgH2; UG0751c10
Synonyms
GTPBP10; GTPBP10 cDNA Clone; GTPBP10 cdna clone
Sequence
atgggttatcctcgtttaggtggagaaggtggaaaaggtggtgatgtctgggttgtagcccagaacagaatgactttaaaacaacttaaagacaggtatcctcggaaacggtttgtggctggagtaggagcaaacagcaaaattagtgcactgaaaggctccaaaggaaaagactgggaaatccctgtgcctgtgggtatttcagtaactgatgaaaatggtaaaattataggagaactcagtaaagaaaatgacagaattttggtagctcaaggaggtcttggtggtaaattacttacaaatttcttaccattgaaaggccagaaacgaataattcaccttgatctaaaacttatagctgatgtaggcctagtaggattcccaaatgctggaaaatcctctttgctaagttgtgtttctcatgcaaaacctgcaattgcagattacgcatttacaacattaaagcctgaacttggaaagataatgtacagtgatttcaaacagatatcagtagctgatcttccgggtttaatagaaggagcacatatgaacaaaggaatgggccacaaattcctcaagcatatagaaagaactagacaactactttttgttgttgatatttctggatttcagctttcttctcacactcaatacaggacagcttttgaaaccataatactgcttacaaaagagttggaattgtacaaagaggaacttcagacaaaacctgcactcttggcagttaataaaatggacttgccagatgcccaagataagttccatgaattgatgagccagctccagaatcctaaagattttctgcatttatttgaaaaaaacatgattccagagaggactgtagagttccaacatatcatccccatatctgcagttactggagaaggaatcgaagaattaaagaattgtataagaaagtcactggatgaacaggccaaccaggaaaatgatgcacttcataagaaacagttgcttaatttgtggatttctgatacaatgtcttctactgagccaccatcaaagcatgctgttactacttccaaaatggatataatttaa
Sequence Length
1077
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
12,577 Da
NCBI Official Full Name
Homo sapiens GTP-binding protein 10 (putative), mRNA
NCBI Official Synonym Full Names
GTP binding protein 10
NCBI Official Symbol
GTPBP10
NCBI Official Synonym Symbols
ObgH2; UG0751c10
NCBI Protein Information
GTP-binding protein 10
UniProt Protein Name
GTP-binding protein 10
Protein Family
UniProt Gene Name
GTPBP10
UniProt Synonym Gene Names
OBGH2; ObgH2
UniProt Entry Name
GTPBA_HUMAN
NCBI Description
Small G proteins, such as GTPBP10, act as molecular switches that play crucial roles in the regulation of fundamental cellular processes such as protein synthesis, nuclear transport, membrane trafficking, and signal transduction (Hirano et al., 2006 [PubMed 17054726]).[supplied by OMIM, Mar 2008]
Uniprot Description
GTPBP10: May be involved in the ribosome maturation process. Complements an ObgE(CgtA) function in E.coli ribosome maturation. Plays a role of GTPase in vitro. When missing, disorganization of the nuceleolar architecture is observed. Belongs to the GTP1/OBG family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Nucleolus
Chromosomal Location of Human Ortholog: 7q21.13
Molecular Function: protein binding
Research Articles on GTPBP10
Similar Products
Product Notes
The GTPBP10 gtpbp10 (Catalog #AAA1267046) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggttatc ctcgtttagg tggagaaggt ggaaaaggtg gtgatgtctg ggttgtagcc cagaacagaa tgactttaaa acaacttaaa gacaggtatc ctcggaaacg gtttgtggct ggagtaggag caaacagcaa aattagtgca ctgaaaggct ccaaaggaaa agactgggaa atccctgtgc ctgtgggtat ttcagtaact gatgaaaatg gtaaaattat aggagaactc agtaaagaaa atgacagaat tttggtagct caaggaggtc ttggtggtaa attacttaca aatttcttac cattgaaagg ccagaaacga ataattcacc ttgatctaaa acttatagct gatgtaggcc tagtaggatt cccaaatgct ggaaaatcct ctttgctaag ttgtgtttct catgcaaaac ctgcaattgc agattacgca tttacaacat taaagcctga acttggaaag ataatgtaca gtgatttcaa acagatatca gtagctgatc ttccgggttt aatagaagga gcacatatga acaaaggaat gggccacaaa ttcctcaagc atatagaaag aactagacaa ctactttttg ttgttgatat ttctggattt cagctttctt ctcacactca atacaggaca gcttttgaaa ccataatact gcttacaaaa gagttggaat tgtacaaaga ggaacttcag acaaaacctg cactcttggc agttaataaa atggacttgc cagatgccca agataagttc catgaattga tgagccagct ccagaatcct aaagattttc tgcatttatt tgaaaaaaac atgattccag agaggactgt agagttccaa catatcatcc ccatatctgc agttactgga gaaggaatcg aagaattaaa gaattgtata agaaagtcac tggatgaaca ggccaaccag gaaaatgatg cacttcataa gaaacagttg cttaatttgt ggatttctga tacaatgtct tctactgagc caccatcaaa gcatgctgtt actacttcca aaatggatat aatttaa. It is sometimes possible for the material contained within the vial of "GTPBP10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
