Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GTF2H5 cdna clone

GTF2H5 cDNA Clone

Gene Names
GTF2H5; TTD; TFB5; TTD3; TTDA; TFIIH; TTD-A; TGF2H5; C6orf175; bA120J8.2
Synonyms
GTF2H5; GTF2H5 cDNA Clone; GTF2H5 cdna clone
Ordering
For Research Use Only!
Sequence
atggtcaacgtcttgaaaggagtgcttatagaatgtgatcctgccatgaagcagtttctgctgtacttggatgagtccaatgccctggggaagaagttcatcattcaagacattgatgacactcacgtctttgtaatagcagaattggttaatgtcctccaggagcgagtgggtgaattaatggaccaaaatgctttttcccttacccagaaatga
Sequence Length
216
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
8,053 Da
NCBI Official Full Name
Homo sapiens general transcription factor IIH, polypeptide 5, mRNA
NCBI Official Synonym Full Names
general transcription factor IIH subunit 5
NCBI Official Symbol
GTF2H5
NCBI Official Synonym Symbols
TTD; TFB5; TTD3; TTDA; TFIIH; TTD-A; TGF2H5; C6orf175; bA120J8.2
NCBI Protein Information
general transcription factor IIH subunit 5
UniProt Protein Name
General transcription factor IIH subunit 5
UniProt Gene Name
GTF2H5
UniProt Synonym Gene Names
C6orf175; TTDA
UniProt Entry Name
TF2H5_HUMAN

NCBI Description

This gene encodes a subunit of transcription/repair factor TFIIH, which functions in gene transcription and DNA repair. This protein stimulates ERCC3/XPB ATPase activity to trigger DNA opening during DNA repair, and is implicated in regulating cellular levels of TFIIH. Mutations in this gene result in trichothiodystrophy, complementation group A. [provided by RefSeq, Mar 2009]

Uniprot Description

GTF2H5: Component of the TFIIH basal transcription factor involved in nucleotide excision repair (NER) of DNA and, when complexed to CAK, in RNA transcription by RNA polymerase II. Necessary for the stability of the TFIIH complex and for the presence of normal levels of TFIIH in the cell. Defects in GTF2H5 are a cause of trichothiodystrophy photosensitive (TTDP). TTDP is an autosomal recessive disease characterized by sulfur-deficient brittle hair and nails, ichthyosis, mental retardation, impaired sexual development, abnormal facies and cutaneous photosensitivity correlated with a nucleotide excision repair (NER) defect. Neonates with trichothiodystrophy and ichthyosis are usually born with a collodion membrane. The severity of the ichthyosis after the membrane is shed is variable, ranging from a mild to severe lamellar ichthyotic phenotype. There are no reports of skin cancer associated with TTDP. Belongs to the TFB5 family.

Protein type: DNA repair, damage; DNA-binding

Chromosomal Location of Human Ortholog: 6q25.3

Cellular Component: nucleoplasm

Biological Process: mRNA capping; nucleotide-excision repair; nucleotide-excision repair, DNA duplex unwinding; nucleotide-excision repair, DNA incision; nucleotide-excision repair, DNA incision, 3'-to lesion; nucleotide-excision repair, DNA incision, 5'-to lesion; nucleotide-excision repair, preincision complex assembly; nucleotide-excision repair, preincision complex stabilization; RNA elongation from RNA polymerase I promoter; RNA elongation from RNA polymerase II promoter; termination of RNA polymerase I transcription; transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase I promoter; transcription initiation from RNA polymerase II promoter; transcription-coupled nucleotide-excision repair

Disease: Trichothiodystrophy 3, Photosensitive

Research Articles on GTF2H5

Similar Products

Product Notes

The GTF2H5 gtf2h5 (Catalog #AAA1272716) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcaacg tcttgaaagg agtgcttata gaatgtgatc ctgccatgaa gcagtttctg ctgtacttgg atgagtccaa tgccctgggg aagaagttca tcattcaaga cattgatgac actcacgtct ttgtaatagc agaattggtt aatgtcctcc aggagcgagt gggtgaatta atggaccaaa atgctttttc ccttacccag aaatga. It is sometimes possible for the material contained within the vial of "GTF2H5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.