Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GSTZ1 cdna clone

GSTZ1 cDNA Clone

Gene Names
GSTZ1; MAI; MAAI; GSTZ1-1
Synonyms
GSTZ1; GSTZ1 cDNA Clone; GSTZ1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggcggggaagcccatcctctattcctatttccgaagctcctgctcatggagagttcgaattgctctggccttgaaaggcatcgactacgagacggtgcccatcaatctcataaaggatgggggccaacagttttctaaggacttccaggcactgaatcctatgaagcaggtgccaaccctgaagattgatggaatcaccattcaccagtcactggccatcattgagtatctagaggagatgcgtcccactccgcgacttctgcctcaggacccaaagaagagggccagcgtgcgtatgatttctgacctcatcgctggtggcatccagcccctgcagaacctgtctgtcctgaagcaagtgggagaggagatgcagctgacctgggcccagaacgccatcacttgtggctttaacgccctggagcagatcctacagagcacagcgggcatatactgtgtaggagacgaggtgaccatggctgatctgtgcttggtgcctcaggtggcaaatgctgaaagattcaaggtggatctcaccccctaccctaccatcagctccatcaacaagaggctgctggtcttggaggccttccaggtgtctcacccctgccggcagccagatacacccactgagctgagggcctag
Sequence Length
651
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,472 Da
NCBI Official Full Name
Homo sapiens glutathione transferase zeta 1, mRNA
NCBI Official Synonym Full Names
glutathione S-transferase zeta 1
NCBI Official Symbol
GSTZ1
NCBI Official Synonym Symbols
MAI; MAAI; GSTZ1-1
NCBI Protein Information
maleylacetoacetate isomerase
UniProt Protein Name
Maleylacetoacetate isomerase
Protein Family
UniProt Gene Name
GSTZ1
UniProt Synonym Gene Names
MAAI; MAAI
UniProt Entry Name
MAAI_HUMAN

NCBI Description

This gene is a member of the glutathione S-transferase (GSTs) super-family which encodes multifunctional enzymes important in the detoxification of electrophilic molecules, including carcinogens, mutagens, and several therapeutic drugs, by conjugation with glutathione. This enzyme catalyzes the conversion of maleylacetoacetate to fumarylacetoacatate, which is one of the steps in the phenylalanine/tyrosine degradation pathway. Deficiency of a similar gene in mouse causes oxidative stress. Several transcript variants of this gene encode multiple protein isoforms. [provided by RefSeq, Jul 2015]

Uniprot Description

GSTZ1: Bifunctional enzyme showing minimal glutathione- conjugating activity with ethacrynic acid and 7-chloro-4- nitrobenz-2-oxa-1,3-diazole and maleylacetoacetate isomerase activity. Has also low glutathione peroxidase activity with T- butyl and cumene hydroperoxides. Is able to catalyze the glutathione dependent oxygenation of dichloroacetic acid to glyoxylic acid. Belongs to the GST superfamily. Zeta family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 5.2.1.2; Isomerase; Transferase; Xenobiotic Metabolism - drug metabolism - cytochrome P450; Oxidoreductase; Mitochondrial; Xenobiotic Metabolism - metabolism by cytochrome P450; EC 2.5.1.18; Amino Acid Metabolism - tyrosine; Other Amino Acids Metabolism - glutathione

Chromosomal Location of Human Ortholog: 14q24.3

Cellular Component: cytosol; mitochondrion

Molecular Function: glutathione peroxidase activity; glutathione transferase activity; maleylacetoacetate isomerase activity; protein binding; protein homodimerization activity

Biological Process: glutathione metabolic process; L-phenylalanine catabolic process

Research Articles on GSTZ1

Similar Products

Product Notes

The GSTZ1 gstz1 (Catalog #AAA1272224) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggcgg ggaagcccat cctctattcc tatttccgaa gctcctgctc atggagagtt cgaattgctc tggccttgaa aggcatcgac tacgagacgg tgcccatcaa tctcataaag gatgggggcc aacagttttc taaggacttc caggcactga atcctatgaa gcaggtgcca accctgaaga ttgatggaat caccattcac cagtcactgg ccatcattga gtatctagag gagatgcgtc ccactccgcg acttctgcct caggacccaa agaagagggc cagcgtgcgt atgatttctg acctcatcgc tggtggcatc cagcccctgc agaacctgtc tgtcctgaag caagtgggag aggagatgca gctgacctgg gcccagaacg ccatcacttg tggctttaac gccctggagc agatcctaca gagcacagcg ggcatatact gtgtaggaga cgaggtgacc atggctgatc tgtgcttggt gcctcaggtg gcaaatgctg aaagattcaa ggtggatctc accccctacc ctaccatcag ctccatcaac aagaggctgc tggtcttgga ggccttccag gtgtctcacc cctgccggca gccagataca cccactgagc tgagggccta g. It is sometimes possible for the material contained within the vial of "GSTZ1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.