Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GSTP1 cdna clone

GSTP1 cDNA Clone

Gene Names
GSTP1; PI; DFN7; GST3; GSTP; FAEES3; HEL-S-22
Synonyms
GSTP1; GSTP1 cDNA Clone; GSTP1 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgccctacaccgtggtctatttcccagttcgaggccgctgcgcggccctgcgcatgctgctggcagatcagggccagagctggaaggaggaggtggtgaccgtggagacgtggcaggagggctcactcaaagcctcctgcctatacgggcagctccccaagttccaggacggagacctcaccctgtaccagtccaataccatcctgcgtcacctgggccgcacccttgggctctatgggaaggaccagcaggaggcagccctggtggacatggtgaatgacggcgtggaggacctccgctgcaaatacgtctccctcatctacaccaactatgaggcgggcaaggatgactatgtgaaggcactgcccgggcaactgaagccttttgagaccctgctgtcccagaaccagggaggcaagaccttcattgtgggagaccagatctccttcgctgactacaacctgctggacttgctgctgatccatgaggtcctagcccctggctgcctggatgcgttccccctgctctcagcatatgtggggcgcctcagcgcccggcccaagctcaaggccttcctggcctcccctgagtacgtgaacctccccatcaatggcaacgggaaacagtga
Sequence Length
633
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,356 Da
NCBI Official Full Name
Homo sapiens glutathione S-transferase pi 1, mRNA
NCBI Official Synonym Full Names
glutathione S-transferase pi 1
NCBI Official Symbol
GSTP1
NCBI Official Synonym Symbols
PI; DFN7; GST3; GSTP; FAEES3; HEL-S-22
NCBI Protein Information
glutathione S-transferase P
UniProt Protein Name
Glutathione S-transferase P
Protein Family
UniProt Gene Name
GSTP1
UniProt Synonym Gene Names
FAEES3; GST3
UniProt Entry Name
GSTP1_HUMAN

NCBI Description

Glutathione S-transferases (GSTs) are a family of enzymes that play an important role in detoxification by catalyzing the conjugation of many hydrophobic and electrophilic compounds with reduced glutathione. Based on their biochemical, immunologic, and structural properties, the soluble GSTs are categorized into 4 main classes: alpha, mu, pi, and theta. This GST family member is a polymorphic gene encoding active, functionally different GSTP1 variant proteins that are thought to function in xenobiotic metabolism and play a role in susceptibility to cancer, and other diseases. [provided by RefSeq, Jul 2008]

Uniprot Description

GSTP1: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. Regulates negatively CDK5 activity via p25/p35 translocation to prevent neurodegeneration. Homodimer. Interacts with CDK5. Belongs to the GST superfamily. Pi family.

Protein type: EC 2.5.1.18; Xenobiotic Metabolism - drug metabolism - cytochrome P450; Xenobiotic Metabolism - metabolism by cytochrome P450; Transferase; Other Amino Acids Metabolism - glutathione

Chromosomal Location of Human Ortholog: 11q13

Cellular Component: cytoplasm; cytosol; extracellular space; intracellular; mitochondrion; vesicle

Molecular Function: glutathione peroxidase activity; glutathione transferase activity; JUN kinase binding; kinase regulator activity; protein binding

Biological Process: central nervous system development; glutathione metabolic process; linoleic acid metabolic process; negative regulation of apoptosis; negative regulation of biosynthetic process; negative regulation of fibroblast proliferation; negative regulation of I-kappaB kinase/NF-kappaB cascade; negative regulation of interleukin-1 beta production; negative regulation of JNK activity; negative regulation of MAP kinase activity; negative regulation of nitric-oxide synthase biosynthetic process; negative regulation of protein kinase activity; negative regulation of stress-activated MAPK cascade; negative regulation of tumor necrosis factor production; positive regulation of superoxide release; regulation of stress-activated MAPK cascade; response to reactive oxygen species; xenobiotic metabolic process

Research Articles on GSTP1

Similar Products

Product Notes

The GSTP1 gstp1 (Catalog #AAA1271902) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgccct acaccgtggt ctatttccca gttcgaggcc gctgcgcggc cctgcgcatg ctgctggcag atcagggcca gagctggaag gaggaggtgg tgaccgtgga gacgtggcag gagggctcac tcaaagcctc ctgcctatac gggcagctcc ccaagttcca ggacggagac ctcaccctgt accagtccaa taccatcctg cgtcacctgg gccgcaccct tgggctctat gggaaggacc agcaggaggc agccctggtg gacatggtga atgacggcgt ggaggacctc cgctgcaaat acgtctccct catctacacc aactatgagg cgggcaagga tgactatgtg aaggcactgc ccgggcaact gaagcctttt gagaccctgc tgtcccagaa ccagggaggc aagaccttca ttgtgggaga ccagatctcc ttcgctgact acaacctgct ggacttgctg ctgatccatg aggtcctagc ccctggctgc ctggatgcgt tccccctgct ctcagcatat gtggggcgcc tcagcgcccg gcccaagctc aaggccttcc tggcctcccc tgagtacgtg aacctcccca tcaatggcaa cgggaaacag tga. It is sometimes possible for the material contained within the vial of "GSTP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.