Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GSTO1 cdna clone

GSTO1 cDNA Clone

Gene Names
GSTO1; P28; SPG-R; GSTO 1-1; GSTTLp28; HEL-S-21
Synonyms
GSTO1; GSTO1 cDNA Clone; GSTO1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccggggagtcagccaggagcttggggaagggaagcgcgcccccggggccggtcccggagggctcgatccgcatctacagcatgaggttctgcccgtttgctgagaggacgcgtctagtcctgaaggccaagggaatcaggcatgaagtcatcaatatcaacctgaaaaataagcctgagtggttctttaagaaaaatccctttggtctggtgccagttctggaaaacagtcagggtcagctgatctacgagtctgccatcacctgtgagtacctggatgaagcatacccagggaagaagctgttgccggatgacccctatgagaaagcttgccagaagatgatcttagagttgttttctaaggtgccatccttggtaggaagctttattagaagccaaaataaagaagactatgctggcctaaaagaagaatttcgtaaagaatttaccaagctagaggaggttctgactaataagaagacgaccttctttggtggcaattctatctctatgattgattacctcatctggccctggtttgaacggctggaagcaatgaagttaaatgagtgtgtagaccacactccaaaactgaaactgtggatggcagccatgaaggaagatcccacagtctcagccctgcttactagtgagaaagactggcaaggtttcctagagctctacttacagaacagccctgaggcctgtgactatgggctctga
Sequence Length
726
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,796 Da
NCBI Official Full Name
Homo sapiens glutathione S-transferase omega 1, mRNA
NCBI Official Synonym Full Names
glutathione S-transferase omega 1
NCBI Official Symbol
GSTO1
NCBI Official Synonym Symbols
P28; SPG-R; GSTO 1-1; GSTTLp28; HEL-S-21
NCBI Protein Information
glutathione S-transferase omega-1
UniProt Protein Name
Glutathione S-transferase omega-1
Protein Family
UniProt Gene Name
GSTO1
UniProt Synonym Gene Names
GSTTLP28; MMA(V) reductase; SPG-R
UniProt Entry Name
GSTO1_HUMAN

NCBI Description

The protein encoded by this gene is an omega class glutathione S-transferase (GST) with glutathione-dependent thiol transferase and dehydroascorbate reductase activities. GSTs are involved in the metabolism of xenobiotics and carcinogens. The encoded protein acts as a homodimer and is found in the cytoplasm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]

Uniprot Description

GSTO1: Exhibits glutathione-dependent thiol transferase and dehydroascorbate reductase activities. Has S-(phenacyl)glutathione reductase activity. Has also glutathione S-transferase activity. Participates in the biotransformation of inorganic arsenic and reduces monomethylarsonic acid (MMA) and dimethylarsonic acid. Belongs to the GST superfamily. Omega family.

Protein type: Other Amino Acids Metabolism - glutathione; EC 1.20.4.2; EC 1.8.5.1; Xenobiotic Metabolism - drug metabolism - cytochrome P450; Xenobiotic Metabolism - metabolism by cytochrome P450; Transferase; EC 2.5.1.18

Chromosomal Location of Human Ortholog: 10q25.1

Cellular Component: cytoplasm; cytosol

Molecular Function: glutathione dehydrogenase (ascorbate) activity; glutathione transferase activity; methylarsonate reductase activity; oxidoreductase activity; protein binding

Biological Process: glutathione metabolic process; L-ascorbic acid metabolic process; methylation; positive regulation of skeletal muscle contraction via regulation of the release of sequestered calcium ion; xenobiotic catabolic process

Research Articles on GSTO1

Similar Products

Product Notes

The GSTO1 gsto1 (Catalog #AAA1269713) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccgggg agtcagccag gagcttgggg aagggaagcg cgcccccggg gccggtcccg gagggctcga tccgcatcta cagcatgagg ttctgcccgt ttgctgagag gacgcgtcta gtcctgaagg ccaagggaat caggcatgaa gtcatcaata tcaacctgaa aaataagcct gagtggttct ttaagaaaaa tccctttggt ctggtgccag ttctggaaaa cagtcagggt cagctgatct acgagtctgc catcacctgt gagtacctgg atgaagcata cccagggaag aagctgttgc cggatgaccc ctatgagaaa gcttgccaga agatgatctt agagttgttt tctaaggtgc catccttggt aggaagcttt attagaagcc aaaataaaga agactatgct ggcctaaaag aagaatttcg taaagaattt accaagctag aggaggttct gactaataag aagacgacct tctttggtgg caattctatc tctatgattg attacctcat ctggccctgg tttgaacggc tggaagcaat gaagttaaat gagtgtgtag accacactcc aaaactgaaa ctgtggatgg cagccatgaa ggaagatccc acagtctcag ccctgcttac tagtgagaaa gactggcaag gtttcctaga gctctactta cagaacagcc ctgaggcctg tgactatggg ctctga. It is sometimes possible for the material contained within the vial of "GSTO1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.