Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GSTA1 cdna clone

GSTA1 cDNA Clone

Gene Names
GSTA1; GST2; GTH1; GSTA1-1; GST-epsilon
Synonyms
GSTA1; GSTA1 cDNA Clone; GSTA1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagagaagcccaagctccactacttcaatgcacggggcagaatggagtccacccggtggctcctggctgcagctggagtagagtttgaagagaaatttataaaatctgcagaagatttggacaagttaagaaatgatggatatttgatgttccagcaagtgccaatggttgagattgatgggatgaagctggtgcagaccagagccattctcaactacattgccagcaaatacaacctctatgggaaagacataaaggagagagccctgattgatatgtatatagaaggtatagcagatttgggtgaaatgatcctccttctgcccgtatgtccacctgaggaaaaagatgccaagcttgccttgatcaaagagaaaataaaaaatcgctacttccctgcctttgaaaaagtcttaaagagccatggacaagactaccttgttggcaacaagctgagccgggctgacattcatctggtggaacttctctactacgtcgaggagcttgactccagtcttatctccagcttccctctgctgaaggccctgaaaaccagaatcagcaacctgcccacagtgaagaagtttctacagcctggcagcccaaggaagcctcccatggatgagaaatctttagaagaagcaaggaagattttcaggttttaa
Sequence Length
669
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,631 Da
NCBI Official Full Name
Homo sapiens glutathione S-transferase alpha 1, mRNA
NCBI Official Synonym Full Names
glutathione S-transferase alpha 1
NCBI Official Symbol
GSTA1
NCBI Official Synonym Symbols
GST2; GTH1; GSTA1-1; GST-epsilon
NCBI Protein Information
glutathione S-transferase A1
UniProt Protein Name
Glutathione S-transferase A1
Protein Family
UniProt Gene Name
GSTA1
UniProt Entry Name
GSTA1_HUMAN

NCBI Description

This gene encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]

Uniprot Description

GSTA1: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. Belongs to the GST superfamily. Alpha family.

Protein type: Xenobiotic Metabolism - metabolism by cytochrome P450; EC 2.5.1.18; Transferase; Xenobiotic Metabolism - drug metabolism - cytochrome P450; Other Amino Acids Metabolism - glutathione

Chromosomal Location of Human Ortholog: 6p12.1

Cellular Component: cytosol

Molecular Function: glutathione peroxidase activity; glutathione transferase activity

Biological Process: epithelial cell differentiation; glutathione metabolic process; linoleic acid metabolic process; metabolic process

Research Articles on GSTA1

Similar Products

Product Notes

The GSTA1 gsta1 (Catalog #AAA1268637) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaga agcccaagct ccactacttc aatgcacggg gcagaatgga gtccacccgg tggctcctgg ctgcagctgg agtagagttt gaagagaaat ttataaaatc tgcagaagat ttggacaagt taagaaatga tggatatttg atgttccagc aagtgccaat ggttgagatt gatgggatga agctggtgca gaccagagcc attctcaact acattgccag caaatacaac ctctatggga aagacataaa ggagagagcc ctgattgata tgtatataga aggtatagca gatttgggtg aaatgatcct ccttctgccc gtatgtccac ctgaggaaaa agatgccaag cttgccttga tcaaagagaa aataaaaaat cgctacttcc ctgcctttga aaaagtctta aagagccatg gacaagacta ccttgttggc aacaagctga gccgggctga cattcatctg gtggaacttc tctactacgt cgaggagctt gactccagtc ttatctccag cttccctctg ctgaaggccc tgaaaaccag aatcagcaac ctgcccacag tgaagaagtt tctacagcct ggcagcccaa ggaagcctcc catggatgag aaatctttag aagaagcaag gaagattttc aggttttaa. It is sometimes possible for the material contained within the vial of "GSTA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.