Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GSDMC cdna clone

GSDMC cDNA Clone

Gene Names
GSDMC; MLZE
Synonyms
GSDMC; GSDMC cDNA Clone; GSDMC cdna clone
Ordering
For Research Use Only!
Sequence
atgccctccatgttggaacgcattagcaaaaatttggtcaaagagattggaagcaaagacctgacatctgtcaaatacctattgagtgccaccaaattacgtcagtttgttatattacgaaagaagaaggattctcgttcatcattttgggaacaatctgactatgttccagttgaattctccctcaatgacatcctggagccaagttcttcagtcctagaaactgttgtgacaggaccgttccacttcagtgacattatgatccagaagcataaggctgacatgggtgtgaatgttggtatagaagtgagtgtgtcaggggaggcctctgtggaccatggatgctccctcgagtttcaaattgttaccatcccatcaccaaacctggaagactttcaaaaaaggaaactgttggatccagagccatcatttctgaaggagtgccggaggagaggggacaacctgtacgtggtgacagaggctgttgaactgatcaacaatactgtgctgtacgatagcagtagtgtgaatattttagggaaaattgctctttggattacctatggcaagggtcaaggccaaggagagagtctcagagtgaagaagaaggcgctgactcttcagaaaggcatggtgatggcttataagagaaagcagctggttatcaaggagaaagccattctcatctcagatgatgatgaacagagaacctttcaagatgagtacgaaatttccgaaatggtaggctactgtgctgcgaggagtgaggggttgctaccatcatttcataccatctctccaaccctcttcaatgcctcatccaatgatatgaagttaaaaccagagctatttctgacacagcaatttttgagcgggcatttgccaaaatacgaacaagttcacatcctcccagtaggaagaatagaggaacccttctggcaaaatttcaagcatctacaagaggaggttttccagaaaataaagacactggctcagctctcaaaggatgttcaggatgtcatgttctacagtatcctggccatgctcagagacagaggggctctacaggacctgatgaacatgctggaattggacagctcaggtcatttggatggccctggtggtgccatcctaaagaaacttcaacaggattcaaaccatgcatggtttaacccaaaggaccccattctttatctccttgaagccataatggtgctgagtgacttccaacacgatttgctggcctgttccatggagaagaggatcctgcttcagcaacaggagctggtaaggagcatcctggagccaaacttcagatacccctggagcattcccttcaccctcaaacctgagctcctcgccccactccagagtgagggtttggccatcacctatggcctgctggaggagtgtggccttaggacggagctggataaccccaggtcaacctgggatgtagaagcaaagatgcccctgtctgccctctatgggactctctcattgctgcagcagctggctgaggcctaa
Sequence Length
1527
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,692 Da
NCBI Official Full Name
Homo sapiens gasdermin C, mRNA
NCBI Official Synonym Full Names
gasdermin C
NCBI Official Symbol
GSDMC
NCBI Official Synonym Symbols
MLZE
NCBI Protein Information
gasdermin-C
UniProt Protein Name
Gasdermin-C
Protein Family
UniProt Gene Name
GSDMC
UniProt Synonym Gene Names
MLZE
UniProt Entry Name
GSDMC_HUMAN

Uniprot Description

MLZE: Belongs to the gasdermin family.

Chromosomal Location of Human Ortholog: 8q24.21

Cellular Component: cytoplasm; microtubule organizing center; mitochondrion

Research Articles on GSDMC

Similar Products

Product Notes

The GSDMC gsdmc (Catalog #AAA1269075) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccctcca tgttggaacg cattagcaaa aatttggtca aagagattgg aagcaaagac ctgacatctg tcaaatacct attgagtgcc accaaattac gtcagtttgt tatattacga aagaagaagg attctcgttc atcattttgg gaacaatctg actatgttcc agttgaattc tccctcaatg acatcctgga gccaagttct tcagtcctag aaactgttgt gacaggaccg ttccacttca gtgacattat gatccagaag cataaggctg acatgggtgt gaatgttggt atagaagtga gtgtgtcagg ggaggcctct gtggaccatg gatgctccct cgagtttcaa attgttacca tcccatcacc aaacctggaa gactttcaaa aaaggaaact gttggatcca gagccatcat ttctgaagga gtgccggagg agaggggaca acctgtacgt ggtgacagag gctgttgaac tgatcaacaa tactgtgctg tacgatagca gtagtgtgaa tattttaggg aaaattgctc tttggattac ctatggcaag ggtcaaggcc aaggagagag tctcagagtg aagaagaagg cgctgactct tcagaaaggc atggtgatgg cttataagag aaagcagctg gttatcaagg agaaagccat tctcatctca gatgatgatg aacagagaac ctttcaagat gagtacgaaa tttccgaaat ggtaggctac tgtgctgcga ggagtgaggg gttgctacca tcatttcata ccatctctcc aaccctcttc aatgcctcat ccaatgatat gaagttaaaa ccagagctat ttctgacaca gcaatttttg agcgggcatt tgccaaaata cgaacaagtt cacatcctcc cagtaggaag aatagaggaa cccttctggc aaaatttcaa gcatctacaa gaggaggttt tccagaaaat aaagacactg gctcagctct caaaggatgt tcaggatgtc atgttctaca gtatcctggc catgctcaga gacagagggg ctctacagga cctgatgaac atgctggaat tggacagctc aggtcatttg gatggccctg gtggtgccat cctaaagaaa cttcaacagg attcaaacca tgcatggttt aacccaaagg accccattct ttatctcctt gaagccataa tggtgctgag tgacttccaa cacgatttgc tggcctgttc catggagaag aggatcctgc ttcagcaaca ggagctggta aggagcatcc tggagccaaa cttcagatac ccctggagca ttcccttcac cctcaaacct gagctcctcg ccccactcca gagtgagggt ttggccatca cctatggcct gctggaggag tgtggcctta ggacggagct ggataacccc aggtcaacct gggatgtaga agcaaagatg cccctgtctg ccctctatgg gactctctca ttgctgcagc agctggctga ggcctaa. It is sometimes possible for the material contained within the vial of "GSDMC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.