Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GRAMD1A cdna clone

GRAMD1A cDNA Clone

Gene Names
GRAMD1A; KIAA1533
Synonyms
GRAMD1A; GRAMD1A cDNA Clone; GRAMD1A cdna clone
Ordering
For Research Use Only!
Sequence
atgcagagctggtacagtatgctgagccccacttataagcagcgtaatgaggacttccggaaactgttcagcaaactccccgaagcagaacgcctcattgtggattactcctgcgccctgcagcgtgagatcctgctccagggccgcctctacctctctgagaactggatctgcttctacagcaacatcttccgctgggagaccacgatctccatccagctgaaggaagtgacatgtctgaagaaggaaaagacggccaagctgatccccaacgccatccagatctgcacggagagcgagaagcatttcttcacttcctttggggcccgtgaccgctgcttcctcctcatcttccgcctctggcagaatgcactgcttgaaaagacgctgagtccccgcgagctctggcacctggtgcatcagtgctacggctcagagctgggcctcaccagtgaggatgaggactatgtctcccccttgcagctgaacggtctggggacccccaaggaagtgggagatgtgatcgccctgagcgacatcacctcctcgggggcagctgaccgcagccaggagccaagcccagtgggttcgcgccgtggccatgtcacgcccaacctttcccgagccagcagcgacgcagaccatggggcagaggaggacaaggaggagcaggtagacagccagccagacgcctcctccagccagacagtgaccccggtggctgaacccccgagcacagagcccacccagcctgacgggcccaccaccctgggccccttggatctgctgcccagtgaggagctattgacagacacaagtaactcctcttcatccactggggaggaagcagacttggctgccctgcttcccgacctctccggccgcctcctcatcaactctgtcttccatgtgggcgctgagcggctccagcagatgctcttctcggactcgcccttcctccagggcttcctacagcagtgcaagttcacagacgtgaccctgagcccctggagtggggacagcaagtgccaccagcgccgggtgctgacgtacaccatccccatcagcaacccactgggccccaagagcgcctccgtggtggagacacagacgctgttccggcgcggcccccaggccggcgggtgtgtggtggactccgaggtgctgacgcagggcatcccctaccaggactacttctacactgcccaccgctactgcatcctgggtctggcccggaacaaggcgcggctccgagtgtcttctgagatccgctaccgaaagcagccgtggagcctggtgaagtcgctcattgagaagaactcgtggagcggcattgaagactatttccaccatctggagcgagagctcgccaaggctgagaagctgtctctggaggaaggcgggaaggatgcccggggcttgctatccggcctgcggcggcggaagcggcccctgagctggcgggctcacggggacgggccccagcacccagatcctgacccctgtgcccgggccggcattcacacctcgggctccctcagctcccgcttctccgaaccatctgtggaccagggccccggggcaggcatccccagtgccctggttctcatcagcattgtgatctgtgtgagccttatcatcctcatcgccctcaacgtcctgctcttctaccgcctctggtccctggaaaggacagcccacacctttgagtcctggcacagcctggccctggccaagggcaagttcccccagacggccacagagtgggccgagatcctggcgctgcagaagcaattccacagcgtggaggtgcacaagtggaggcagatcctgcgggcctccgtggagctcctggatgagatgaagttctcgctggagaagctgcaccaaggcatcacagtctcagaccctccctttgacacccagccccggcccgatgacagcttttcctga
Sequence Length
1953
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
80,278 Da
NCBI Official Full Name
Homo sapiens GRAM domain containing 1A, mRNA
NCBI Official Synonym Full Names
GRAM domain containing 1A
NCBI Official Symbol
GRAMD1A
NCBI Official Synonym Symbols
KIAA1533
NCBI Protein Information
GRAM domain-containing protein 1A
UniProt Protein Name
GRAM domain-containing protein 1A
UniProt Gene Name
GRAMD1A
UniProt Synonym Gene Names
KIAA1533
UniProt Entry Name
GRM1A_HUMAN

Uniprot Description

GRAMD1A: 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 19q13.13

Molecular Function: protein binding

Similar Products

Product Notes

The GRAMD1A gramd1a (Catalog #AAA1270482) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagagct ggtacagtat gctgagcccc acttataagc agcgtaatga ggacttccgg aaactgttca gcaaactccc cgaagcagaa cgcctcattg tggattactc ctgcgccctg cagcgtgaga tcctgctcca gggccgcctc tacctctctg agaactggat ctgcttctac agcaacatct tccgctggga gaccacgatc tccatccagc tgaaggaagt gacatgtctg aagaaggaaa agacggccaa gctgatcccc aacgccatcc agatctgcac ggagagcgag aagcatttct tcacttcctt tggggcccgt gaccgctgct tcctcctcat cttccgcctc tggcagaatg cactgcttga aaagacgctg agtccccgcg agctctggca cctggtgcat cagtgctacg gctcagagct gggcctcacc agtgaggatg aggactatgt ctcccccttg cagctgaacg gtctggggac ccccaaggaa gtgggagatg tgatcgccct gagcgacatc acctcctcgg gggcagctga ccgcagccag gagccaagcc cagtgggttc gcgccgtggc catgtcacgc ccaacctttc ccgagccagc agcgacgcag accatggggc agaggaggac aaggaggagc aggtagacag ccagccagac gcctcctcca gccagacagt gaccccggtg gctgaacccc cgagcacaga gcccacccag cctgacgggc ccaccaccct gggccccttg gatctgctgc ccagtgagga gctattgaca gacacaagta actcctcttc atccactggg gaggaagcag acttggctgc cctgcttccc gacctctccg gccgcctcct catcaactct gtcttccatg tgggcgctga gcggctccag cagatgctct tctcggactc gcccttcctc cagggcttcc tacagcagtg caagttcaca gacgtgaccc tgagcccctg gagtggggac agcaagtgcc accagcgccg ggtgctgacg tacaccatcc ccatcagcaa cccactgggc cccaagagcg cctccgtggt ggagacacag acgctgttcc ggcgcggccc ccaggccggc gggtgtgtgg tggactccga ggtgctgacg cagggcatcc cctaccagga ctacttctac actgcccacc gctactgcat cctgggtctg gcccggaaca aggcgcggct ccgagtgtct tctgagatcc gctaccgaaa gcagccgtgg agcctggtga agtcgctcat tgagaagaac tcgtggagcg gcattgaaga ctatttccac catctggagc gagagctcgc caaggctgag aagctgtctc tggaggaagg cgggaaggat gcccggggct tgctatccgg cctgcggcgg cggaagcggc ccctgagctg gcgggctcac ggggacgggc cccagcaccc agatcctgac ccctgtgccc gggccggcat tcacacctcg ggctccctca gctcccgctt ctccgaacca tctgtggacc agggccccgg ggcaggcatc cccagtgccc tggttctcat cagcattgtg atctgtgtga gccttatcat cctcatcgcc ctcaacgtcc tgctcttcta ccgcctctgg tccctggaaa ggacagccca cacctttgag tcctggcaca gcctggccct ggccaagggc aagttccccc agacggccac agagtgggcc gagatcctgg cgctgcagaa gcaattccac agcgtggagg tgcacaagtg gaggcagatc ctgcgggcct ccgtggagct cctggatgag atgaagttct cgctggagaa gctgcaccaa ggcatcacag tctcagaccc tccctttgac acccagcccc ggcccgatga cagcttttcc tga. It is sometimes possible for the material contained within the vial of "GRAMD1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.