GPR89A cdna clone
GPR89A cDNA Clone
Gene Names
GPR89A; GPHR; GPR89; SH120; GPR89B; UNQ192
Synonyms
GPR89A; GPR89A cDNA Clone; GPR89A cdna clone
Sequence
atgagtttcctcatcgactccagcatcatgattacctcccagatactattttttggatttgggtggcttttcttcatgcgccaattgtttaaagactatgagatacgtcagtatgttgtacaggtgatcttctccgtgacgtttgcattttcttgcaccatgtttgagctcatcatctttgaaatcttaggagtattgaatagcagctcccgttattttcactggaaaatgaacctgtgtgtaattctgctgatcctggttttcatggtgcctttttacattggctattttattgtgagcaatatccgactactgcataaacaacgactgcttttttcctgtctcttatggctgacctttatgtatttcttctggaaactaggagatccctttcccattctcagcccaaaacatgggatcttatccatagaacagctcatcagccgggttggtgtgattggagtgactctcatggctcttctttctggatttggtgctgtcaactgcccatacacttacatgtcttacttcctcaggaatgtgactgacacggatattctagccctggaacggcgactgctgcaaaccatggatatgatcataagcaaaaagaaaaggatggcaatggcacggagaacaatgttccagaagggggaagtgcataacaaaccatcaggtttctggggaatgataaaaagtgttaccacttcagcatcaggaagtgaaaatcttactcttattcaacaggaagtggatgctttggaagaattaagcaggcagctttttctggaaacagctgatctatatgctaccaaggagagaatagaatactccaaaaccttcaaggggaaatattttaattttcttggttactttttctctatttactgtgtttggaaaattttcatggctaccatcaatattgtttttgatcgagttgggaaaacggatcctgtcacaagaggcattgagatcactgtgaattatctgggaatccaatttgatgtgaagttttggtcccaacacatttccttcattcttgttggaataatcatcgtcacatccatcagaggattgctgatcactcttaccaagttcttttatgccatctctagcagtaagtcctccaatgtcattgtcctgctattagcacagataatgggcatgtactttgtctcctctgtgctgctgatccgaatgagtatgcctttagaataccgcaccataatcactgaagtccttggagaactgcagttcaacttctatcaccgttggtttgatgtgatcttcctggtcagcgctctctctagcatactcttcctctatttggctcacaaacaggcaccagagaagcaaatggcaccttga
Sequence Length
1368
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
14,650 Da
NCBI Official Full Name
Homo sapiens G protein-coupled receptor 89A, mRNA
NCBI Official Synonym Full Names
G protein-coupled receptor 89A
NCBI Official Symbol
GPR89A
NCBI Official Synonym Symbols
GPHR; GPR89; SH120; GPR89B; UNQ192
NCBI Protein Information
Golgi pH regulator A
UniProt Protein Name
Golgi pH regulator A
Protein Family
UniProt Gene Name
GPR89A
UniProt Synonym Gene Names
GPHRA; GPR89; SH120
UniProt Entry Name
GPHRA_HUMAN
NCBI Description
GPR89A is a nearly identical copy of the GPR89B gene (MIM 612806).[supplied by OMIM, Jun 2009]
Uniprot Description
GPR89A: Voltage dependent anion channel required for acidification and functions of the Golgi apparatus that may function in counter-ion conductance. Belongs to the Golgi pH regulator (TC 1.A.38) family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 1q21.1
Molecular Function: signal transducer activity; voltage-gated anion channel activity
Biological Process: intracellular pH reduction; positive regulation of I-kappaB kinase/NF-kappaB cascade
Similar Products
Product Notes
The GPR89A gpr89a (Catalog #AAA1268532) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtttcc tcatcgactc cagcatcatg attacctccc agatactatt ttttggattt gggtggcttt tcttcatgcg ccaattgttt aaagactatg agatacgtca gtatgttgta caggtgatct tctccgtgac gtttgcattt tcttgcacca tgtttgagct catcatcttt gaaatcttag gagtattgaa tagcagctcc cgttattttc actggaaaat gaacctgtgt gtaattctgc tgatcctggt tttcatggtg cctttttaca ttggctattt tattgtgagc aatatccgac tactgcataa acaacgactg cttttttcct gtctcttatg gctgaccttt atgtatttct tctggaaact aggagatccc tttcccattc tcagcccaaa acatgggatc ttatccatag aacagctcat cagccgggtt ggtgtgattg gagtgactct catggctctt ctttctggat ttggtgctgt caactgccca tacacttaca tgtcttactt cctcaggaat gtgactgaca cggatattct agccctggaa cggcgactgc tgcaaaccat ggatatgatc ataagcaaaa agaaaaggat ggcaatggca cggagaacaa tgttccagaa gggggaagtg cataacaaac catcaggttt ctggggaatg ataaaaagtg ttaccacttc agcatcagga agtgaaaatc ttactcttat tcaacaggaa gtggatgctt tggaagaatt aagcaggcag ctttttctgg aaacagctga tctatatgct accaaggaga gaatagaata ctccaaaacc ttcaagggga aatattttaa ttttcttggt tactttttct ctatttactg tgtttggaaa attttcatgg ctaccatcaa tattgttttt gatcgagttg ggaaaacgga tcctgtcaca agaggcattg agatcactgt gaattatctg ggaatccaat ttgatgtgaa gttttggtcc caacacattt ccttcattct tgttggaata atcatcgtca catccatcag aggattgctg atcactctta ccaagttctt ttatgccatc tctagcagta agtcctccaa tgtcattgtc ctgctattag cacagataat gggcatgtac tttgtctcct ctgtgctgct gatccgaatg agtatgcctt tagaataccg caccataatc actgaagtcc ttggagaact gcagttcaac ttctatcacc gttggtttga tgtgatcttc ctggtcagcg ctctctctag catactcttc ctctatttgg ctcacaaaca ggcaccagag aagcaaatgg caccttga. It is sometimes possible for the material contained within the vial of "GPR89A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
