Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GPR34 cdna clone

GPR34 cDNA Clone

Gene Names
GPR34; LYPSR1
Synonyms
GPR34; GPR34 cDNA Clone; GPR34 cdna clone
Ordering
For Research Use Only!
Sequence
atgagaagtcataccataacaatgacgacaacttcagtcagcagctggccttactcctcccacagaatgcgctttataaccaatcatagcgaccaaccgccacaaaacttctcagcaacaccaaatgttactacctgtcccatggatgaaaaattgctatctactgtgttaaccacatcctactctgttattttcatcgtgggactggttgggaacataatcgccctctatgtatttctgggtattcaccgtaaaagaaattccattcaaatttatctacttaacgtagccattgcagacctcctactcatcttctgcctccctttccgaataatgtatcatattaaccaaaacaagtggacactaggtgtgattctgtgcaaggttgtgggaacactgttttatatgaacatgtacattagcattattttgcttggattcatcagtttggatcgctatataaaaattaatcggtctatacagcaacggaaggcaataacaaccaaacaaagtatttatgtctgttgtatagtatggatgcttgctcttggtggattcctaactatgattattttaacacttaagaaaggagggcataattccacaatgtgtttccattacagagataagcataacgcaaaaggagaagccatttttaacttcattcttgtggtaatgttctggctaattttcttactaataatcctttcatatattaagattgggaagaatctattgaggatttctaaaaggaggtcaaaatttcctaattctggtaaatatgccactacagctcgtaactcctttattgtacttatcatttttactatatgttttgttccctatcatgcctttcgattcatctacatttcttcacagctaaatgtatcatcttgctactggaaagaaattgttcacaaaaccaatgagatcatgctggttctctcatctttcaatagttgcttagatccagtcatgtatttcctgatgtccagtaacattcgcaaaataatgtgccaacttctttttagacgatttcaaggtgaaccaagtaggagtgaaagcacttcagaatttaaaccaggatactccctgcatgatacatctgtggcagtgaaaatacagtctagttctaaaagtacttga
Sequence Length
1146
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,860 Da
NCBI Official Full Name
Homo sapiens G protein-coupled receptor 34, mRNA
NCBI Official Synonym Full Names
G protein-coupled receptor 34
NCBI Official Symbol
GPR34
NCBI Official Synonym Symbols
LYPSR1
NCBI Protein Information
probable G-protein coupled receptor 34
UniProt Protein Name
Probable G-protein coupled receptor 34
UniProt Gene Name
GPR34
UniProt Entry Name
GPR34_HUMAN

NCBI Description

G protein-coupled receptors (GPCRs), such as GPR34, are integral membrane proteins containing 7 putative transmembrane domains (TMs). These proteins mediate signals to the interior of the cell via activation of heterotrimeric G proteins that in turn activate various effector proteins, ultimately resulting in a physiologic response.[supplied by OMIM, Apr 2006]

Uniprot Description

GPR34: Orphan receptor. Belongs to the G-protein coupled receptor 1 family.

Protein type: Membrane protein, multi-pass; Receptor, GPCR; Membrane protein, integral; GPCR, family 1

Chromosomal Location of Human Ortholog: Xp11.4

Cellular Component: integral to plasma membrane

Molecular Function: G-protein coupled receptor activity; purinergic nucleotide receptor activity, G-protein coupled

Biological Process: G-protein coupled receptor protein signaling pathway

Research Articles on GPR34

Similar Products

Product Notes

The GPR34 gpr34 (Catalog #AAA1272284) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagaagtc ataccataac aatgacgaca acttcagtca gcagctggcc ttactcctcc cacagaatgc gctttataac caatcatagc gaccaaccgc cacaaaactt ctcagcaaca ccaaatgtta ctacctgtcc catggatgaa aaattgctat ctactgtgtt aaccacatcc tactctgtta ttttcatcgt gggactggtt gggaacataa tcgccctcta tgtatttctg ggtattcacc gtaaaagaaa ttccattcaa atttatctac ttaacgtagc cattgcagac ctcctactca tcttctgcct ccctttccga ataatgtatc atattaacca aaacaagtgg acactaggtg tgattctgtg caaggttgtg ggaacactgt tttatatgaa catgtacatt agcattattt tgcttggatt catcagtttg gatcgctata taaaaattaa tcggtctata cagcaacgga aggcaataac aaccaaacaa agtatttatg tctgttgtat agtatggatg cttgctcttg gtggattcct aactatgatt attttaacac ttaagaaagg agggcataat tccacaatgt gtttccatta cagagataag cataacgcaa aaggagaagc catttttaac ttcattcttg tggtaatgtt ctggctaatt ttcttactaa taatcctttc atatattaag attgggaaga atctattgag gatttctaaa aggaggtcaa aatttcctaa ttctggtaaa tatgccacta cagctcgtaa ctcctttatt gtacttatca tttttactat atgttttgtt ccctatcatg cctttcgatt catctacatt tcttcacagc taaatgtatc atcttgctac tggaaagaaa ttgttcacaa aaccaatgag atcatgctgg ttctctcatc tttcaatagt tgcttagatc cagtcatgta tttcctgatg tccagtaaca ttcgcaaaat aatgtgccaa cttcttttta gacgatttca aggtgaacca agtaggagtg aaagcacttc agaatttaaa ccaggatact ccctgcatga tacatctgtg gcagtgaaaa tacagtctag ttctaaaagt acttga. It is sometimes possible for the material contained within the vial of "GPR34, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.