Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GPR180 cdna clone

GPR180 cDNA Clone

Gene Names
GPR180; ITR
Synonyms
GPR180; GPR180 cDNA Clone; GPR180 cdna clone
Ordering
For Research Use Only!
Sequence
atgggggggctgcggctgctggctgtggccctcacgtgctgctggtggccgcagggcagccagggtaagaccctgcggggcagcttcagcagcaccgcggcccaggacgcccagggccagcgcatcggccacttcgagttccatggtgaccatgctcttctgtgtgtcagaatcaacaacatagcagtagctgttggaaaagaagctaaactctacctgttccaagcccaggaatggctaaagctacagcaaagcagtcatggttatagctgtagtgaaaaattatccaaagctcagttgacaatgaccatgaaccagaccgaacataatctgacagtgtcccagattccgtctccacaaacgtggcatgtgttttatgcagacaagtatacatgccaagatgacaaggagaattctcaggtggaagatatcccatttgaaatggtgttactaaacccagatgctgaagggaatccatttgatcattttagtgctggagaatctgttactccaaagatggaatag
Sequence Length
525
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,395 Da
NCBI Official Full Name
Homo sapiens G protein-coupled receptor 180, mRNA
NCBI Official Synonym Full Names
G protein-coupled receptor 180
NCBI Official Symbol
GPR180
NCBI Official Synonym Symbols
ITR
NCBI Protein Information
integral membrane protein GPR180
UniProt Protein Name
Integral membrane protein GPR180
Protein Family
UniProt Gene Name
GPR180
UniProt Synonym Gene Names
ITR
UniProt Entry Name
GP180_HUMAN

NCBI Description

This gene encodes a protein that is a member of the G protein-coupled receptor superfamily. This protein is produced predominantly in vascular smooth muscle cells and may play an important role in the regulation of vascular remodeling. [provided by RefSeq, Jul 2008]

Uniprot Description

GPR180:

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 13q32.1

Research Articles on GPR180

Similar Products

Product Notes

The GPR180 gpr180 (Catalog #AAA1275894) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggggc tgcggctgct ggctgtggcc ctcacgtgct gctggtggcc gcagggcagc cagggtaaga ccctgcgggg cagcttcagc agcaccgcgg cccaggacgc ccagggccag cgcatcggcc acttcgagtt ccatggtgac catgctcttc tgtgtgtcag aatcaacaac atagcagtag ctgttggaaa agaagctaaa ctctacctgt tccaagccca ggaatggcta aagctacagc aaagcagtca tggttatagc tgtagtgaaa aattatccaa agctcagttg acaatgacca tgaaccagac cgaacataat ctgacagtgt cccagattcc gtctccacaa acgtggcatg tgttttatgc agacaagtat acatgccaag atgacaagga gaattctcag gtggaagata tcccatttga aatggtgtta ctaaacccag atgctgaagg gaatccattt gatcatttta gtgctggaga atctgttact ccaaagatgg aatag. It is sometimes possible for the material contained within the vial of "GPR180, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.