GPR125 cdna clone
GPR125 cDNA Clone
Gene Names
ADGRA3; PGR21; TEM5L; GPR125
Synonyms
GPR125; GPR125 cDNA Clone; GPR125 cdna clone
Sequence
atgccactgaagaggaataactctaaataccctccgcttgaattgccgtctttctacatgactccatctcatcgccaagttgtgtttgaaggagacagccttcctttccagtgcatggcttcatatattgatcaggacatgcaagtgttgtggtatcaggatgggagaatagttgaaaccgatgaatcgcaaggtatttttgttgaaaagaacatgattcacaactgctccttgattgcaagtgccctaaccatttctaatattcaggctggatctactggaaattggggctgtcatgtccagaccaaacgtgggaataatacgaggactgtggatattgtggtattagagagttctgcacagtactgtccgccagagagggtggtaaacaacaaaggtgacttcagatggcccagaacattggcaggcattactgcatatctgcagtgtacgcggaacacccatggcagtgggatatatcccggaaacccacaggatgagagaaaagcttggcgcagatgtgatagaggtggcttttgggcagatgatgattattctcgctgtcagtatgcaaatgatgtcactagagttctttatatgtttaatcagatgcccctcaatcttaccaatgccgtggcaacagctcgacagttactggcttacactgtggaagcagccaacttttctgacaaaatggatgttatatttgtggcagaaatgattgaaaaatttggaagatttaccaaggaggaaaaatcaaaagagctaggtgacgtgatggttgacattgcaagtaacatcatgttggctgatgaacgtgtcctgtggctggcgcagagggaagctaaagcctgcagtaggattgtgcagtgtcttcagcgcattgctacctaccggctagccggtggagctcacgtttattcaacatatccacccaatattgctctggaagcttatgtcatcaagtctactggcttcacggggatgacctgtaccgtgttccagaaagtggcagcctctgatcgtacaggactttcggattatgggaggcgggatccagagggaaacctggataagcagctgagctttaagtgcaatgtttcaaatacattttcgagtctggcactaaaggggaaattccggtga
Sequence Length
1146
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
42,973 Da
NCBI Official Full Name
Homo sapiens G protein-coupled receptor 125, mRNA
NCBI Official Synonym Full Names
adhesion G protein-coupled receptor A3
NCBI Official Symbol
ADGRA3
NCBI Official Synonym Symbols
PGR21; TEM5L; GPR125
NCBI Protein Information
adhesion G protein-coupled receptor A3
UniProt Protein Name
Adhesion G protein-coupled receptor A3
UniProt Gene Name
ADGRA3
UniProt Entry Name
AGRA3_HUMAN
NCBI Description
This gene encodes a member of the G protein-coupled receptor superfamily. This membrane protein may play a role in tumor angiogenesis through its interaction with the human homolog of the Drosophila disc large tumor suppressor gene. This gene is mapped to a candidate region of chromosome 4 which may be associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2012]
Uniprot Description
GPR125: Orphan receptor. Belongs to the G-protein coupled receptor 2 family. LN-TM7 subfamily. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: GPCR, family 2; Membrane protein, integral; Receptor, GPCR; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 4p15.2
Research Articles on GPR125
Similar Products
Product Notes
The GPR125 adgra3 (Catalog #AAA1269989) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccactga agaggaataa ctctaaatac cctccgcttg aattgccgtc tttctacatg actccatctc atcgccaagt tgtgtttgaa ggagacagcc ttcctttcca gtgcatggct tcatatattg atcaggacat gcaagtgttg tggtatcagg atgggagaat agttgaaacc gatgaatcgc aaggtatttt tgttgaaaag aacatgattc acaactgctc cttgattgca agtgccctaa ccatttctaa tattcaggct ggatctactg gaaattgggg ctgtcatgtc cagaccaaac gtgggaataa tacgaggact gtggatattg tggtattaga gagttctgca cagtactgtc cgccagagag ggtggtaaac aacaaaggtg acttcagatg gcccagaaca ttggcaggca ttactgcata tctgcagtgt acgcggaaca cccatggcag tgggatatat cccggaaacc cacaggatga gagaaaagct tggcgcagat gtgatagagg tggcttttgg gcagatgatg attattctcg ctgtcagtat gcaaatgatg tcactagagt tctttatatg tttaatcaga tgcccctcaa tcttaccaat gccgtggcaa cagctcgaca gttactggct tacactgtgg aagcagccaa cttttctgac aaaatggatg ttatatttgt ggcagaaatg attgaaaaat ttggaagatt taccaaggag gaaaaatcaa aagagctagg tgacgtgatg gttgacattg caagtaacat catgttggct gatgaacgtg tcctgtggct ggcgcagagg gaagctaaag cctgcagtag gattgtgcag tgtcttcagc gcattgctac ctaccggcta gccggtggag ctcacgttta ttcaacatat ccacccaata ttgctctgga agcttatgtc atcaagtcta ctggcttcac ggggatgacc tgtaccgtgt tccagaaagt ggcagcctct gatcgtacag gactttcgga ttatgggagg cgggatccag agggaaacct ggataagcag ctgagcttta agtgcaatgt ttcaaataca ttttcgagtc tggcactaaa ggggaaattc cggtga. It is sometimes possible for the material contained within the vial of "GPR125, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
