Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GPD2 cdna clone

GPD2 cDNA Clone

Gene Names
GPD2; GDH2; GPDM; mGPDH
Synonyms
GPD2; GPD2 cDNA Clone; GPD2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcatttcaaaaggcagtgaaagggactcttgttggaggaggtgctcttgcaactgttttaggactttctcagtttgctcattacagaaggaaacaaatgaacctggcctatgttaaagcagcagactgcatttcagaaccagttaacagggagcctccttccagagaagctcagctactgactttgcaaaacacatctgaatttgatatccttgttattggaggaggagcaacaggaagtggctgtgcgctagatgctgtcaccagaggactaaaaacagcccttgtagaaagagatgatttctcatcagggaccagcagcagaagcactaaattgatccatggtggtgtgagatatctgcagaaggccatcatgaagttggatattgagcagtataggatggtaaaagaagcccttcatgagcgtgccaacctgctagaaattgctccccatttatcagctccattgcctataatgcttccagtttacaagtggtggcagttaccttactactgggtaggaatcaagctgtatgatttggttgcaggaagcaattgcctaaaaagcagttatgtcctcagcaaatcaagagcccttgaacatttcccaatgctccagaaggacaaactggtaggagcaattgtctactatgacggacaacataacgatgcacggatgaaccttgccattgctctgactgctgccaggtatggggctgccacagccaattacatggaggtagtgagcttgctcaagaagacagacccccagacagggaaagtgcatgtgagcggcgcacggtgcaaggatgtcctcacagggcaggaatttgacgtgagagccaaatgtgttatcaatgccacgggacctttcacggactctgtgcgcaaaatggatgataaagacgcagcagctatctgccagccaagtgctggtgtccatattgtgatgcctggttattacagcccagagagcatgggacttcttgacccagcgaccagtgatgggcgagttattttcttcttaccctggcaaaagatgacgatcgctggcactactgatactccaactgatgttacacaccatccaattccttcagaagaagatatcaacttcattttgaatgaagtataa
Sequence Length
1137
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
67,531 Da
NCBI Official Full Name
Homo sapiens glycerol-3-phosphate dehydrogenase 2 (mitochondrial), mRNA
NCBI Official Synonym Full Names
glycerol-3-phosphate dehydrogenase 2
NCBI Official Symbol
GPD2
NCBI Official Synonym Symbols
GDH2; GPDM; mGPDH
NCBI Protein Information
glycerol-3-phosphate dehydrogenase, mitochondrial
UniProt Protein Name
Glycerol-3-phosphate dehydrogenase, mitochondrial
UniProt Gene Name
GPD2
UniProt Synonym Gene Names
GPD-M; GPDH-M
UniProt Entry Name
GPDM_HUMAN

NCBI Description

The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]

Uniprot Description

GPD2: localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]

Protein type: EC 1.1.5.3; Calcium-binding; Lipid Metabolism - glycerophospholipid; Oxidoreductase; Mitochondrial

Chromosomal Location of Human Ortholog: 2q24.1

Cellular Component: mitochondrial inner membrane

Molecular Function: glycerol-3-phosphate dehydrogenase activity

Biological Process: cellular lipid metabolic process

Disease: Diabetes Mellitus, Noninsulin-dependent

Research Articles on GPD2

Similar Products

Product Notes

The GPD2 gpd2 (Catalog #AAA1267032) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcatttc aaaaggcagt gaaagggact cttgttggag gaggtgctct tgcaactgtt ttaggacttt ctcagtttgc tcattacaga aggaaacaaa tgaacctggc ctatgttaaa gcagcagact gcatttcaga accagttaac agggagcctc cttccagaga agctcagcta ctgactttgc aaaacacatc tgaatttgat atccttgtta ttggaggagg agcaacagga agtggctgtg cgctagatgc tgtcaccaga ggactaaaaa cagcccttgt agaaagagat gatttctcat cagggaccag cagcagaagc actaaattga tccatggtgg tgtgagatat ctgcagaagg ccatcatgaa gttggatatt gagcagtata ggatggtaaa agaagccctt catgagcgtg ccaacctgct agaaattgct ccccatttat cagctccatt gcctataatg cttccagttt acaagtggtg gcagttacct tactactggg taggaatcaa gctgtatgat ttggttgcag gaagcaattg cctaaaaagc agttatgtcc tcagcaaatc aagagccctt gaacatttcc caatgctcca gaaggacaaa ctggtaggag caattgtcta ctatgacgga caacataacg atgcacggat gaaccttgcc attgctctga ctgctgccag gtatggggct gccacagcca attacatgga ggtagtgagc ttgctcaaga agacagaccc ccagacaggg aaagtgcatg tgagcggcgc acggtgcaag gatgtcctca cagggcagga atttgacgtg agagccaaat gtgttatcaa tgccacggga cctttcacgg actctgtgcg caaaatggat gataaagacg cagcagctat ctgccagcca agtgctggtg tccatattgt gatgcctggt tattacagcc cagagagcat gggacttctt gacccagcga ccagtgatgg gcgagttatt ttcttcttac cctggcaaaa gatgacgatc gctggcacta ctgatactcc aactgatgtt acacaccatc caattccttc agaagaagat atcaacttca ttttgaatga agtataa. It is sometimes possible for the material contained within the vial of "GPD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.