GPAA1 cdna clone
GPAA1 cDNA Clone
Gene Names
GPAA1; GAA1; hGAA1
Synonyms
GPAA1; GPAA1 cDNA Clone; GPAA1 cdna clone
Sequence
atgggcctcctgtcggacccggttcgccggcgcgcgctcgcccgcctagtgctgcgcctcaacgcgccgttgtgcgtgctgagctacgtggcgggcatcgcctggttcttggcgctggttttcccgccgctgacccagcgcacttacatgtcggagaacgccatgggctccaccatggtggaggagcagtttgcgggcggagaccgtgcccgggcttttgcccgggacttcgccgcccaccgcaagaagtcgggggctctgccagtggcctggcttgaacggacgatgcggtcagtagggctggaggtctacacgcagagtttctcccggaaactgcccttcccagatgagacccacgagcgctatatggtgtcgggcaccaacgtgtacggcatcctgcgggccccgcgtgctgccagcaccgagtcgcttgtgctcaccgtgccctgtggctctgactctaccaacagccaggctgtggggctgctgctggcactggctgcccacttccgggggcagatttattgggccaaagatatcgtcttcctggtaacagaacatgaccttctgggcactgaggcttggcttgaagcctaccacgatgtcaatgtcactggcatgcagtcgtctcccctgcagggccgagctggggccattcaggcagccgtggccctggagctgagcagtgatgtggtcaccagcctcgatgtggccgtggaggggcttaacgggcagctgcccaaccttgacctgctcaatctcttccagaccttctgccagaaagggggcctgttgtgcacgcttcagggcaagctgcagcccgaggactggacatcattggatggaccgctgcagggcctgcagacactgctgctcatggttctgcggcaggcctccggccgcccccacggctcccatggcctcttcctgcgctaccgtgtggaggccctaaccctgcgtggcatcaatagcttccgccagtacaagtatgacctggtggcagtgggcaaggctttggagggcatgttccgcaagctcaaccacctcctggagcgcctgcaccagtccttcttcctctacttgctccccggcctctcccgcttcgtctccatcggcctctacatgcccgctgtcggcttcttgctcctggtccttggtctcaaggctctggaactgtggatgcagctgcatgaggctggaatgggccttgaggagcccgggggtgcccctggccccagtgtaccccttcccccatcacagggtgtggggctggcctcgctcgtggcacctctgctgatctcacaggccatgggactggccctctatgtcctgccagtgctgggccaacacgttgccacccagcacttcccagtggcagaggctgaggctgtggtgctgacactgctggcgatttatgcagctggcctggccctgccccacaatacccaccgggtggtaagcacacaggccccagacaggggctggatggcactgaagctggtagccctgatctacctagcactgcagctgggctgcatcgccctcaccaacttctcactgggcttcctgctggccaccaccatggtgcccactgctgcgcttgccaagcctcatgggccccggaccctctatgctgccctgctggtgctgaccagcccggcagccacgctccttggcagcctgttcctgtggcgggagctgcaggaggcgccactgtcactggccgagggctggcagctcttcctggcagcgctagcccagggtgtgctggagcaccacacctacggcgccctgctcttcccactgctgtccctgggcctctacccctgctggctgcttttctggaatgtgctcttctggaagtga
Sequence Length
1866
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
61,098 Da
NCBI Official Full Name
Homo sapiens glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast), mRNA
NCBI Official Synonym Full Names
glycosylphosphatidylinositol anchor attachment 1
NCBI Official Symbol
GPAA1
NCBI Official Synonym Symbols
GAA1; hGAA1
NCBI Protein Information
glycosylphosphatidylinositol anchor attachment 1 protein
UniProt Protein Name
Glycosylphosphatidylinositol anchor attachment 1 protein
Protein Family
UniProt Gene Name
GPAA1
UniProt Synonym Gene Names
GAA1; GPI anchor attachment protein 1; hGAA1
UniProt Entry Name
GPAA1_HUMAN
NCBI Description
Posttranslational glycosylphosphatidylinositol (GPI) anchor attachment serves as a general mechanism for linking proteins to the cell surface membrane. The protein encoded by this gene presumably functions in GPI anchoring at the GPI transfer step. The mRNA transcript is ubiquitously expressed in both fetal and adult tissues. The anchor attachment protein 1 contains an N-terminal signal sequence, 1 cAMP- and cGMP-dependent protein kinase phosphorylation site, 1 leucine zipper pattern, 2 potential N-glycosylation sites, and 8 putative transmembrane domains. [provided by RefSeq, Jul 2008]
Uniprot Description
GPAA1: Essential for GPI-anchoring of precursor proteins but not for GPI synthesis. Acts before or during formation of the carbonyl intermediate. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Endoplasmic reticulum; Membrane protein, multi-pass; Glycan Metabolism - glycosylphosphatidylinositol (GPI)-anchor biosynthesis; Membrane protein, integral
Chromosomal Location of Human Ortholog: 8q24.3
Cellular Component: endoplasmic reticulum membrane; GPI-anchor transamidase complex; membrane
Molecular Function: protein binding
Biological Process: attachment of GPI anchor to protein
Research Articles on GPAA1
Similar Products
Product Notes
The GPAA1 gpaa1 (Catalog #AAA1265963) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcctcc tgtcggaccc ggttcgccgg cgcgcgctcg cccgcctagt gctgcgcctc aacgcgccgt tgtgcgtgct gagctacgtg gcgggcatcg cctggttctt ggcgctggtt ttcccgccgc tgacccagcg cacttacatg tcggagaacg ccatgggctc caccatggtg gaggagcagt ttgcgggcgg agaccgtgcc cgggcttttg cccgggactt cgccgcccac cgcaagaagt cgggggctct gccagtggcc tggcttgaac ggacgatgcg gtcagtaggg ctggaggtct acacgcagag tttctcccgg aaactgccct tcccagatga gacccacgag cgctatatgg tgtcgggcac caacgtgtac ggcatcctgc gggccccgcg tgctgccagc accgagtcgc ttgtgctcac cgtgccctgt ggctctgact ctaccaacag ccaggctgtg gggctgctgc tggcactggc tgcccacttc cgggggcaga tttattgggc caaagatatc gtcttcctgg taacagaaca tgaccttctg ggcactgagg cttggcttga agcctaccac gatgtcaatg tcactggcat gcagtcgtct cccctgcagg gccgagctgg ggccattcag gcagccgtgg ccctggagct gagcagtgat gtggtcacca gcctcgatgt ggccgtggag gggcttaacg ggcagctgcc caaccttgac ctgctcaatc tcttccagac cttctgccag aaagggggcc tgttgtgcac gcttcagggc aagctgcagc ccgaggactg gacatcattg gatggaccgc tgcagggcct gcagacactg ctgctcatgg ttctgcggca ggcctccggc cgcccccacg gctcccatgg cctcttcctg cgctaccgtg tggaggccct aaccctgcgt ggcatcaata gcttccgcca gtacaagtat gacctggtgg cagtgggcaa ggctttggag ggcatgttcc gcaagctcaa ccacctcctg gagcgcctgc accagtcctt cttcctctac ttgctccccg gcctctcccg cttcgtctcc atcggcctct acatgcccgc tgtcggcttc ttgctcctgg tccttggtct caaggctctg gaactgtgga tgcagctgca tgaggctgga atgggccttg aggagcccgg gggtgcccct ggccccagtg taccccttcc cccatcacag ggtgtggggc tggcctcgct cgtggcacct ctgctgatct cacaggccat gggactggcc ctctatgtcc tgccagtgct gggccaacac gttgccaccc agcacttccc agtggcagag gctgaggctg tggtgctgac actgctggcg atttatgcag ctggcctggc cctgccccac aatacccacc gggtggtaag cacacaggcc ccagacaggg gctggatggc actgaagctg gtagccctga tctacctagc actgcagctg ggctgcatcg ccctcaccaa cttctcactg ggcttcctgc tggccaccac catggtgccc actgctgcgc ttgccaagcc tcatgggccc cggaccctct atgctgccct gctggtgctg accagcccgg cagccacgct ccttggcagc ctgttcctgt ggcgggagct gcaggaggcg ccactgtcac tggccgaggg ctggcagctc ttcctggcag cgctagccca gggtgtgctg gagcaccaca cctacggcgc cctgctcttc ccactgctgt ccctgggcct ctacccctgc tggctgcttt tctggaatgt gctcttctgg aagtga. It is sometimes possible for the material contained within the vial of "GPAA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
