Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GOT2 cdna clone

GOT2 cDNA Clone

Gene Names
GOT2; KAT4; KATIV; KYAT4; mitAAT
Synonyms
GOT2; GOT2 cDNA Clone; GOT2 cdna clone
Ordering
For Research Use Only!
Sequence
atggccctgctgcactccggccgcgtcctccccgggatcgccgccgccttccacccgggcctcgccgccgcggcctctgccagagccagctcctggtggacccatgtggaaatgggacctccagatcccattctgggagtcactgaagcctttaagagggacaccaatagcaaaaagatgaatctgggagttggtgcctaccgggatgataatggaaagccttacgttctgcctagcgtccgcaaggcagaggcccagattgccgcaaaaaatttggacaaggaatacctgcccattgggggactggctgaattttgcaaggcatctgcagaactagccctgggtgagaacagcgaagtcttgaagagtggccggtttgtcactgtgcagaccatttctggaactggagccttaaggatcggagccagttttctgcaaagattttttaagttcagccgagatgtctttctgcccaaaccaacctggggaaaccacacacccatcttcagggatgctggcatgcagctacaaggttatcggtattatgaccccaagacttgcggttttgacttcacaggcgctgtggaggatatttcaaaaataccagagcagagtgttcttcttctgcatgcctgcgcccacaatcccacgggagtggacccgcgtccggaacagtggaaggaaatagcaacagtggtgaagaaaaggaatctctttgcgttctttgacatggcctaccaaggctttgccagtggtgatggtgataaggatgcctgggctgtgcgccacttcatcgaacagggcattaatgtttgcctctgccaatcatatgccaagaacatgggcttatatggtgagcgtgtaggagccttcactatggtctgcaaagatgcggatgaagccaaaagggtagagtcacagttgaagatcttgatccgtcccatgtattccaaccctcccctcaatggggcccggattgctgctgccattctgaacaccccagatttgcgaaaacaatggctgcaagaagtgaaagtcatggctgaccgcatcattggcatgcggactcaactggtctccaacctcaagaaggagggttccacccacaattggcaacacatcaccgaccaaattggcatgttctgtttcacagggctaaagcctgaacaggtggagcggctgatcaaggagttctccatctacatgacaaaagatggccgcatctctgtggcaggggtcacctccagcaacgtgggctaccttgcccatgccattcaccaggccaccaagtaa
Sequence Length
1293
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,030 Da
NCBI Official Full Name
Homo sapiens glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2), mRNA
NCBI Official Synonym Full Names
glutamic-oxaloacetic transaminase 2
NCBI Official Symbol
GOT2
NCBI Official Synonym Symbols
KAT4; KATIV; KYAT4; mitAAT
NCBI Protein Information
aspartate aminotransferase, mitochondrial
UniProt Protein Name
Aspartate aminotransferase, mitochondrial
UniProt Gene Name
GOT2
UniProt Synonym Gene Names
mAspAT; FABP-1; FABPpm
UniProt Entry Name
AATM_HUMAN

NCBI Description

Glutamic-oxaloacetic transaminase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and inner-membrane mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]

Uniprot Description

GOT2: Catalyzes the irreversible transamination of the L- tryptophan metabolite L-kynurenine to form kynurenic acid (KA). Plays a key role in amino acid metabolism. Important for metabolite exchange between mitochondria and cytosol. Facilitates cellular uptake of long-chain free fatty acids. Belongs to the class-I pyridoxal-phosphate-dependent aminotransferase family.

Protein type: Amino Acid Metabolism - tyrosine; Amino Acid Metabolism - cysteine and methionine; Amino Acid Metabolism - arginine and proline; EC 2.6.1.7; Mitochondrial; EC 2.6.1.1; Amino Acid Metabolism - alanine, aspartate and glutamate; Amino Acid Metabolism - phenylalanine; Amino Acid Metabolism - phenylalanine, tyrosine and tryptophan biosynthesis; Transferase

Chromosomal Location of Human Ortholog: 16q21

Cellular Component: mitochondrial matrix; mitochondrion; plasma membrane

Molecular Function: aspartate transaminase activity; identical protein binding; pyridoxal phosphate binding

Biological Process: 2-oxoglutarate metabolic process; 4-hydroxyproline catabolic process; amino acid biosynthetic process; aspartate catabolic process; aspartate metabolic process; fatty acid transport; gluconeogenesis; glutamate metabolic process; response to ethanol

Research Articles on GOT2

Similar Products

Product Notes

The GOT2 got2 (Catalog #AAA1265979) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccctgc tgcactccgg ccgcgtcctc cccgggatcg ccgccgcctt ccacccgggc ctcgccgccg cggcctctgc cagagccagc tcctggtgga cccatgtgga aatgggacct ccagatccca ttctgggagt cactgaagcc tttaagaggg acaccaatag caaaaagatg aatctgggag ttggtgccta ccgggatgat aatggaaagc cttacgttct gcctagcgtc cgcaaggcag aggcccagat tgccgcaaaa aatttggaca aggaatacct gcccattggg ggactggctg aattttgcaa ggcatctgca gaactagccc tgggtgagaa cagcgaagtc ttgaagagtg gccggtttgt cactgtgcag accatttctg gaactggagc cttaaggatc ggagccagtt ttctgcaaag attttttaag ttcagccgag atgtctttct gcccaaacca acctggggaa accacacacc catcttcagg gatgctggca tgcagctaca aggttatcgg tattatgacc ccaagacttg cggttttgac ttcacaggcg ctgtggagga tatttcaaaa ataccagagc agagtgttct tcttctgcat gcctgcgccc acaatcccac gggagtggac ccgcgtccgg aacagtggaa ggaaatagca acagtggtga agaaaaggaa tctctttgcg ttctttgaca tggcctacca aggctttgcc agtggtgatg gtgataagga tgcctgggct gtgcgccact tcatcgaaca gggcattaat gtttgcctct gccaatcata tgccaagaac atgggcttat atggtgagcg tgtaggagcc ttcactatgg tctgcaaaga tgcggatgaa gccaaaaggg tagagtcaca gttgaagatc ttgatccgtc ccatgtattc caaccctccc ctcaatgggg cccggattgc tgctgccatt ctgaacaccc cagatttgcg aaaacaatgg ctgcaagaag tgaaagtcat ggctgaccgc atcattggca tgcggactca actggtctcc aacctcaaga aggagggttc cacccacaat tggcaacaca tcaccgacca aattggcatg ttctgtttca cagggctaaa gcctgaacag gtggagcggc tgatcaagga gttctccatc tacatgacaa aagatggccg catctctgtg gcaggggtca cctccagcaa cgtgggctac cttgcccatg ccattcacca ggccaccaag taa. It is sometimes possible for the material contained within the vial of "GOT2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.