Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GOLGA4 cdna clone

GOLGA4 cDNA Clone

Gene Names
GOLGA4; GCP2; GOLG; p230; CRPF46; MU-RMS-40.18
Synonyms
GOLGA4; GOLGA4 cDNA Clone; GOLGA4 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcaagaaactgaagcaaaagatcagcgaggagcagcagcagctccagcaggcgctggctcctgctcaggcgtcctccaattcttcaacaccaacaagaatgaggagcaggacatcttcatttacagagcaacttgatgaaggtacacccaatagagagtcaggtgacacacagtcttttgcacagaagctccagctccgggtgccctccgtggagtctttgtttcgaagtccgataaaggaatctctattccggtcttcttctaaagagtctttggtacgaacatcttccagagaatccctgaatcgacttgacctggacagttctactgccagttttgatccaccctctgatatggatagcgaggctgaagacttggtagggaattcagacagtctcaacaaagaacagttgattcagcggttgcgaagaatggaacgaagcttaagtagctacaggggaaaatattctgagtcatggctccgatcttcatcttga
Sequence Length
501
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
262,328 Da
NCBI Official Full Name
Homo sapiens golgi autoantigen, golgin subfamily a, 4, mRNA
NCBI Official Synonym Full Names
golgin A4
NCBI Official Symbol
GOLGA4
NCBI Official Synonym Symbols
GCP2; GOLG; p230; CRPF46; MU-RMS-40.18
NCBI Protein Information
golgin subfamily A member 4
UniProt Protein Name
Golgin subfamily A member 4
Protein Family
UniProt Gene Name
GOLGA4
UniProt Entry Name
GOGA4_HUMAN

NCBI Description

The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]

Uniprot Description

GOLGA4: May play a role in delivery of transport vesicles containing GPI-linked proteins from the trans-Golgi network through its interaction with MACF1. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle

Chromosomal Location of Human Ortholog: 3p22-p21.3

Cellular Component: cytoplasm; cytosol; Golgi apparatus; intracellular membrane-bound organelle; nucleoplasm; trans-Golgi network

Molecular Function: GTPase binding; protein binding

Biological Process: Golgi to plasma membrane protein transport; positive regulation of axon extension; vesicle-mediated transport

Research Articles on GOLGA4

Similar Products

Product Notes

The GOLGA4 golga4 (Catalog #AAA1272548) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcaaga aactgaagca aaagatcagc gaggagcagc agcagctcca gcaggcgctg gctcctgctc aggcgtcctc caattcttca acaccaacaa gaatgaggag caggacatct tcatttacag agcaacttga tgaaggtaca cccaatagag agtcaggtga cacacagtct tttgcacaga agctccagct ccgggtgccc tccgtggagt ctttgtttcg aagtccgata aaggaatctc tattccggtc ttcttctaaa gagtctttgg tacgaacatc ttccagagaa tccctgaatc gacttgacct ggacagttct actgccagtt ttgatccacc ctctgatatg gatagcgagg ctgaagactt ggtagggaat tcagacagtc tcaacaaaga acagttgatt cagcggttgc gaagaatgga acgaagctta agtagctaca ggggaaaata ttctgagtca tggctccgat cttcatcttg a. It is sometimes possible for the material contained within the vial of "GOLGA4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.