Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GOLGA2 cdna clone

GOLGA2 cDNA Clone

Gene Names
GOLGA2; GM130
Synonyms
GOLGA2; GOLGA2 cDNA Clone; GOLGA2 cdna clone
Ordering
For Research Use Only!
Sequence
atggagtcggttagacaactacaaatggagagagataaatatgcggagaatctcaaaggagagagcgccatgtggcggcagaggatgcagcagatgtcagagcaggtgcacacattgagagaggagaaggaatgtagcatgagtcgggtacaggagctggagacgagcttggctgaactgaggaaccagatggctgaacccccgcccccagagcccccagcagggccctccgaggtggagcagcagctacaagcggaggctgagcacctgcggaaggagctggagggtctggcaggacagcttcaagcccaggtgcaagacaatgagggcttgagtcgcctgaaccgggagcaggaggagaggctgctggagctggagcgggcggccgagctctggggggagcaggcggaggcgcgcaggcaaatcctggagaccatgcagaacgaccgcactaccatcagccgcgcactctcccagaaccgggagctcaaggagcagctggctgagctgcagagcggatttgtaaagctgactaatgagaacatggagatcaccagcgcactgcagtcggagcagcacgtcaagagggagctgggaaagaagctgggcgagctgcaggagaagctgagcgagctgaaggaaacggtggagctgaagagccaagaggctcaaagtctgcagcagcagcgagaccagtacctgggacacctgcagcagtatgtggccgcctatcagcagctgacctctgagaaggaggtgctgcataatcagctactgctgcagacccagctcgtggaccagctgcagcagcaggaagctcagggcaaagcggtggccgagatggcccgccaagagttgcaggaaacccaggagcgcctggaagctgccacccagcagaatcagcagctacgggcccagttgagcctcatggctcaccctggggaaggagatggactggaccgggaggaggaggaggatgaggaggaggaggaggaggaggcggtggcagtacctcagcccatgccaagcatcccggaggacctggagagccgggaagccatggtggcatttttcaactcagctgtagccagtgccgaggaggagcaggcaaggctacgtgggcagctgaaggagcaaagggtgcgctgccggcgcctggctcacctgctggcctcggcccagaaggagcctgaggcagcagccccagccccagggaccgggggtgattctgtgtgtggggagacccaccgggccctgcagggggccatggagaagctgcagagccgctttatggagctcatgcaggagaaggcagacctgaaggagagggtagaggaactggaacatcgctgcatccagctttctggagagacagacaccattggagagtacattgcactgtaccagagccagagggcagtgctgaaggagcggcaccgggagaaggaggagtacatcagcaggctggcccaagacaaggaggagatgaaggtgaagctgctggagctgcaggagctggtcttacggcttgtgggcgaccgcaacgagtggcatggcagattcctggcagctgcccagaaccctgctgatgagcccacttcaggggccccagccccccaggaacttggggctgccaaccagcagggtgatctttgcgaggtgagcctcgccggcagtgtggagcctgcccaaggagaggccagggagggttctccccgtgacaaccccactgcacagcagatcatgcagctgcttcgtgagatgcagaacccccgggagcgcccaggcttgggcagcaacccctgcattccttttttttaccgggctgacgagaatgatgaggtgaagatcactgtcatctaa
Sequence Length
1863
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
70,473 Da
NCBI Official Full Name
Homo sapiens golgi autoantigen, golgin subfamily a, 2, mRNA
NCBI Official Synonym Full Names
golgin A2
NCBI Official Symbol
GOLGA2
NCBI Official Synonym Symbols
GM130
NCBI Protein Information
golgin subfamily A member 2
UniProt Protein Name
Golgin subfamily A member 2
Protein Family
UniProt Gene Name
GOLGA2
UniProt Synonym Gene Names
GM130
UniProt Entry Name
GOGA2_HUMAN

NCBI Description

The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein has been postulated to play roles in the stacking of Golgi cisternae and in vesicular transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Feb 2010]

Uniprot Description

GM130: Golgi auto-antigen; probably involved in maintaining cis-Golgi structure. Part of a larger oligomeric complex. Interacts with p115. Interacts with RAB1B that has been activated by GTP-binding. Interacts with GORASP1/GRASP65 and ZFPL1. Belongs to the GOLGA2 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 9q34.11

Cellular Component: cell-cell adherens junction; cis-Golgi network; ER to Golgi transport vesicle; ER-Golgi intermediate compartment membrane; Golgi apparatus; Golgi cis cisterna; Golgi membrane; nucleus; spindle pole

Molecular Function: microtubule binding; protein binding; protein kinase binding; syntaxin binding

Biological Process: asymmetric cell division; centrosome organization and biogenesis; COPII coating of Golgi vesicle; ER to Golgi vesicle-mediated transport; microtubule nucleation; negative regulation of autophagy; negative regulation of protein binding; positive regulation of protein amino acid glycosylation; protein amino acid glycosylation; protein homotetramerization; spindle assembly

Research Articles on GOLGA2

Similar Products

Product Notes

The GOLGA2 golga2 (Catalog #AAA1275214) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtcgg ttagacaact acaaatggag agagataaat atgcggagaa tctcaaagga gagagcgcca tgtggcggca gaggatgcag cagatgtcag agcaggtgca cacattgaga gaggagaagg aatgtagcat gagtcgggta caggagctgg agacgagctt ggctgaactg aggaaccaga tggctgaacc cccgccccca gagcccccag cagggccctc cgaggtggag cagcagctac aagcggaggc tgagcacctg cggaaggagc tggagggtct ggcaggacag cttcaagccc aggtgcaaga caatgagggc ttgagtcgcc tgaaccggga gcaggaggag aggctgctgg agctggagcg ggcggccgag ctctgggggg agcaggcgga ggcgcgcagg caaatcctgg agaccatgca gaacgaccgc actaccatca gccgcgcact ctcccagaac cgggagctca aggagcagct ggctgagctg cagagcggat ttgtaaagct gactaatgag aacatggaga tcaccagcgc actgcagtcg gagcagcacg tcaagaggga gctgggaaag aagctgggcg agctgcagga gaagctgagc gagctgaagg aaacggtgga gctgaagagc caagaggctc aaagtctgca gcagcagcga gaccagtacc tgggacacct gcagcagtat gtggccgcct atcagcagct gacctctgag aaggaggtgc tgcataatca gctactgctg cagacccagc tcgtggacca gctgcagcag caggaagctc agggcaaagc ggtggccgag atggcccgcc aagagttgca ggaaacccag gagcgcctgg aagctgccac ccagcagaat cagcagctac gggcccagtt gagcctcatg gctcaccctg gggaaggaga tggactggac cgggaggagg aggaggatga ggaggaggag gaggaggagg cggtggcagt acctcagccc atgccaagca tcccggagga cctggagagc cgggaagcca tggtggcatt tttcaactca gctgtagcca gtgccgagga ggagcaggca aggctacgtg ggcagctgaa ggagcaaagg gtgcgctgcc ggcgcctggc tcacctgctg gcctcggccc agaaggagcc tgaggcagca gccccagccc cagggaccgg gggtgattct gtgtgtgggg agacccaccg ggccctgcag ggggccatgg agaagctgca gagccgcttt atggagctca tgcaggagaa ggcagacctg aaggagaggg tagaggaact ggaacatcgc tgcatccagc tttctggaga gacagacacc attggagagt acattgcact gtaccagagc cagagggcag tgctgaagga gcggcaccgg gagaaggagg agtacatcag caggctggcc caagacaagg aggagatgaa ggtgaagctg ctggagctgc aggagctggt cttacggctt gtgggcgacc gcaacgagtg gcatggcaga ttcctggcag ctgcccagaa ccctgctgat gagcccactt caggggcccc agccccccag gaacttgggg ctgccaacca gcagggtgat ctttgcgagg tgagcctcgc cggcagtgtg gagcctgccc aaggagaggc cagggagggt tctccccgtg acaaccccac tgcacagcag atcatgcagc tgcttcgtga gatgcagaac ccccgggagc gcccaggctt gggcagcaac ccctgcattc ctttttttta ccgggctgac gagaatgatg aggtgaagat cactgtcatc taa. It is sometimes possible for the material contained within the vial of "GOLGA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.