Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNPTAB cdna clone

GNPTAB cDNA Clone

Gene Names
GNPTAB; ICD; GNPTA
Synonyms
GNPTAB; GNPTAB cDNA Clone; GNPTAB cdna clone
Ordering
For Research Use Only!
Sequence
atgctgttcaagctcctacagagacagacctatacctgcctgtcccacaggtatgggctctacgtgtgcttcttgggcgtcgttgtcaccatcgtctccgccttccagttcggagaggtggttctggaatggagccgagatcaataccatgttttgtttgattcctatagagacaatattgctggaaagtcctttcagaatcggtctgtgaggtaa
Sequence Length
216
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
UniProt Accession #
Molecular Weight
143,622 Da
NCBI Official Full Name
Homo sapiens N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits, mRNA
NCBI Official Synonym Full Names
N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
NCBI Official Symbol
GNPTAB
NCBI Official Synonym Symbols
ICD; GNPTA
NCBI Protein Information
N-acetylglucosamine-1-phosphotransferase subunits alpha/beta; stealth protein GNPTAB; GlcNAc phosphotransferase; glcNAc-1-phosphotransferase subunits alpha/beta; UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosamine; UDP-N-acetylglucosamine-1-phosphotransferase subunits alpha/beta; glucosamine (UDP-N-acetyl)-lysosomal-enzyme N-acetylglucosamine phosphotransferase
UniProt Protein Name
N-acetylglucosamine-1-phosphotransferase subunits alpha/beta
UniProt Gene Name
GNPTAB
UniProt Synonym Gene Names
GNPTA; KIAA1208
UniProt Entry Name
GNPTA_HUMAN

NCBI Description

This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]

Uniprot Description

GNPTAB: Catalyzes the formation of mannose 6-phosphate (M6P) markers on high mannose type oligosaccharides in the Golgi apparatus. M6P residues are required to bind to the M6P receptors (MPR), which mediate the vesicular transport of lysosomal enzymes to the endosomal/prelysosomal compartment. Defects in GNPTAB are the cause of mucolipidosis type II (MLII); also known as inclusion cell disease or I- cell disease (ICD). MLII is a fatal, autosomal recessive, lysosomal storage disorder characterized by severe clinical and radiologic features, peculiar fibroblast inclusions, and no excessive mucopolysacchariduria. Congenital dislocation of the hip, thoracic deformities, hernia, and hyperplastic gums are evident soon after birth. Defects in GNPTAB are the cause of mucolipidosis type III complementation group A (MLIIIA); also known as variant pseudo-Hurler polydystrophy. MLIIIA is an autosomal recessive disease of lysosomal enzyme targeting. Clinically MLIII is characterized by restricted joint mobility, skeletal dysplasia, and short stature. Mildly coarsened facial features and thickening of the skin have been described. Cardiac valvular disease and corneal clouding may also occur. Half of the reported patients show learning disabilities or mental retardation. Belongs to the stealth family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 2.7.8.17; Transferase; Membrane protein, integral

Chromosomal Location of Human Ortholog: 12q23.2

Cellular Component: Golgi membrane; Golgi apparatus; integral to membrane; nucleus

Molecular Function: UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity; calcium ion binding; transcription factor binding

Biological Process: lysosome organization and biogenesis; carbohydrate phosphorylation; protein secretion; cell differentiation

Disease: Mucolipidosis Iii Alpha/beta; Mucolipidosis Ii Alpha/beta

Research Articles on GNPTAB

Similar Products

Product Notes

The GNPTAB gnptab (Catalog #AAA1277521) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgttca agctcctaca gagacagacc tatacctgcc tgtcccacag gtatgggctc tacgtgtgct tcttgggcgt cgttgtcacc atcgtctccg ccttccagtt cggagaggtg gttctggaat ggagccgaga tcaataccat gttttgtttg attcctatag agacaatatt gctggaaagt cctttcagaa tcggtctgtg aggtaa. It is sometimes possible for the material contained within the vial of "GNPTAB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.