Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNMT cdna clone

GNMT cDNA Clone

Gene Names
GNMT; HEL-S-182mP
Synonyms
GNMT; GNMT cDNA Clone; GNMT cdna clone
Ordering
For Research Use Only!
Sequence
atggtggacagcgtgtaccggacccgctccctgggggtggcggccgaagggctcccggaccagtacgcggacggggaggcggcgcgcgtgtggcagctgtatatcggagacacccgcagccgcaccgccgagtacaaggcatggctgcttgggctgctgcgccagcacggctgccagcgggtgctcgacgtagcctgtggcactggggtggactccattatgctggtggaagagggcttcagtgtgacgagtgtggatgccagtgacaagatgctgaagtatgcacttaaggagcgctggaaccggcggcacgagcccgccttcgacaagtgggtcatcgaagaagccaactggatgactctggacaaagatgtgccccagtcagcagagggtggctttgatgctgtcatctgccttggaaacagtttcgctcacttgccagactgcaaaggggaccagagtgagcaccggctggcgctgaaaaacattgcgagcatggtgcgggcagggggcctactggtcattgatcatcgcaactacgaccacatcctcagtacaggctgtgcacccccagggaagaacatctactataagagtgacttgaccaaggacgtcacaacatcagtgctgatagtgaacaacaaggcccacatggtgaccctggactatacggtgcaggtgccgggggctggccaggatggctctcctggcttgagtaagttccggctctcctactacccacactgtctggcatccttcacggagctgctccaagcagccttcggaggtaagtgccagcacagcgtcctgggcgacttcaagccttacaagccaggccaaacctacattccctgctacttcatccacgtgctcaagaggacagactga
Sequence Length
888
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,742 Da
NCBI Official Full Name
Homo sapiens glycine N-methyltransferase, mRNA
NCBI Official Synonym Full Names
glycine N-methyltransferase
NCBI Official Symbol
GNMT
NCBI Official Synonym Symbols
HEL-S-182mP
NCBI Protein Information
glycine N-methyltransferase
UniProt Protein Name
Glycine N-methyltransferase
UniProt Gene Name
GNMT
UniProt Entry Name
GNMT_HUMAN

NCBI Description

The protein encoded by this gene is an enzyme that catalyzes the conversion of S-adenosyl-L-methionine (along with glycine) to S-adenosyl-L-homocysteine and sarcosine. This protein is found in the cytoplasm and acts as a homotetramer. Defects in this gene are a cause of GNMT deficiency (hypermethioninemia). Alternative splicing results in multiple transcript variants. Naturally occurring readthrough transcription occurs between the upstream CNPY3 (canopy FGF signaling regulator 3) gene and this gene and is represented with GeneID:107080644. [provided by RefSeq, Jan 2016]

Uniprot Description

GNMT: Catalyzes the methylation of glycine by using S- adenosylmethionine (AdoMet) to form N-methylglycine (sarcosine) with the concomitant production of S-adenosylhomocysteine (AdoHcy). Possible crucial role in the regulation of tissue concentration of AdoMet and of metabolism of methionine. Defects in GNMT are the cause of glycine N- methyltransferase deficiency (GNMT deficiency); also known as hypermethioninemia. The only clinical abnormalities in patients with this deficiency are mild hepatomegaly and chronic elevation of serum transaminases. Belongs to the class I-like SAM-binding methyltransferase superfamily. Glycine N-methyltransferase family.

Protein type: EC 2.1.1.20; Methyltransferase; Amino Acid Metabolism - glycine, serine and threonine

Chromosomal Location of Human Ortholog: 6p12

Cellular Component: cytoplasm; cytosol

Molecular Function: glycine binding; glycine N-methyltransferase activity; protein binding

Biological Process: glyoxylate metabolic process; protein homotetramerization; S-adenosylmethionine metabolic process

Disease: Glycine N-methyltransferase Deficiency

Research Articles on GNMT

Similar Products

Product Notes

The GNMT gnmt (Catalog #AAA1271367) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggaca gcgtgtaccg gacccgctcc ctgggggtgg cggccgaagg gctcccggac cagtacgcgg acggggaggc ggcgcgcgtg tggcagctgt atatcggaga cacccgcagc cgcaccgccg agtacaaggc atggctgctt gggctgctgc gccagcacgg ctgccagcgg gtgctcgacg tagcctgtgg cactggggtg gactccatta tgctggtgga agagggcttc agtgtgacga gtgtggatgc cagtgacaag atgctgaagt atgcacttaa ggagcgctgg aaccggcggc acgagcccgc cttcgacaag tgggtcatcg aagaagccaa ctggatgact ctggacaaag atgtgcccca gtcagcagag ggtggctttg atgctgtcat ctgccttgga aacagtttcg ctcacttgcc agactgcaaa ggggaccaga gtgagcaccg gctggcgctg aaaaacattg cgagcatggt gcgggcaggg ggcctactgg tcattgatca tcgcaactac gaccacatcc tcagtacagg ctgtgcaccc ccagggaaga acatctacta taagagtgac ttgaccaagg acgtcacaac atcagtgctg atagtgaaca acaaggccca catggtgacc ctggactata cggtgcaggt gccgggggct ggccaggatg gctctcctgg cttgagtaag ttccggctct cctactaccc acactgtctg gcatccttca cggagctgct ccaagcagcc ttcggaggta agtgccagca cagcgtcctg ggcgacttca agccttacaa gccaggccaa acctacattc cctgctactt catccacgtg ctcaagagga cagactga. It is sometimes possible for the material contained within the vial of "GNMT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.