Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

GNAZ cdna clone

GNAZ cDNA Clone

Synonyms
GNAZ; GNAZ cDNA Clone; GNAZ cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgggatgtcggcaaagctcagaggaaaaagaagcagcccggcggtcccggagaattgaccgccacctgcgctcagagagccagcggcaacgccgcgaaatcaagctgctcctgctgggcaccagcaactcaggcaagagcaccatcgtcaaacagatgaagatcatccacagcggcggcttcaacctggaggcctgcaaggagtacaagcccctcatcatctacaatgccatcgactcgctgacccgcatcatccgggccctggccgccctcaggatcgacttccacaaccccgaccgcgcctacgacgctgtgcagctctttgcgctgacgggccccgctgagagcaagggcgagatcacacccgagctgctgggtgtcatgcgacggctctgggccgaccaaggggcacaggcctgcttcagccgctccagcgagtaccacctggaggacaacgcggcctactacctgaacgacctggagcgcatcgccgcagctgactatatccccactgtcgaggacatcctgcgctcccgggacatgaccacgggcattgtggagaacaagttcaccttcaaggagctcaccttcaagatggtggacgtgggggggcagaggtcagagcgcaaaaagtggatccactgcttcgagggcgtcacagccatcatcttctgtgtggagctcagcggctacgacctgaaactctacgaggataaccagacaagtcggatggcagagagcttgcgcctctttgactccatctgcaacaacaactggttcatcaacacctcactcatcctcttcctgaacaagaaggacctgctggcagagaagatccgccgcatcccgctcaccatctgctttcccgagtacaagggccagaacacgtacgaggaggccgctgtctacatccagcggcagtttgaagacctgaaccgcaacaaggagaccaaggagatctactcccacttcacctgcgccaccgacaccagtaacatccagtttgtcttcgacgcggtgacagacgtcatcatacagaacaatctcaagtacattggcctttgctga
Sequence Length
1068
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,924 Da
NCBI Official Full Name
Homo sapiens guanine nucleotide binding protein (G protein), alpha z polypeptide, mRNA
NCBI Official Synonym Full Names
G protein subunit alpha z
NCBI Official Symbol
GNAZ
NCBI Protein Information
guanine nucleotide-binding protein G(z) subunit alpha
UniProt Protein Name
Guanine nucleotide-binding protein G(z) subunit alpha
UniProt Gene Name
GNAZ
UniProt Entry Name
GNAZ_HUMAN

NCBI Description

The protein encoded by this gene is a member of a G protein subfamily that mediates signal transduction in pertussis toxin-insensitive systms. This encoded protein may play a role in maintaining the ionic balance of perilymphatic and endolymphatic cochlear fluids. [provided by RefSeq, Jul 2008]

Uniprot Description

G-alpha(z): Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems. G proteins are composed of 3 units; alpha, beta and gamma. The alpha chain contains the guanine nucleotide binding site. Belongs to the G-alpha family. G(i/o/t/z) subfamily.

Protein type: Nuclear envelope; G protein, heterotrimeric alpha G((i/o/t/z)); G protein, heterotrimeric; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 22q11.22

Cellular Component: endoplasmic reticulum; heterotrimeric G-protein complex; nuclear envelope; plasma membrane

Molecular Function: G-protein beta/gamma-subunit binding; GTP binding; GTPase activity; metabotropic serotonin receptor binding; receptor signaling protein activity

Biological Process: G-protein coupled receptor protein signaling pathway; G-protein signaling, coupled to cAMP nucleotide second messenger; protein folding

Research Articles on GNAZ

Similar Products

Product Notes

The GNAZ gnaz (Catalog #AAA1278777) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggatgtc ggcaaagctc agaggaaaaa gaagcagccc ggcggtcccg gagaattgac cgccacctgc gctcagagag ccagcggcaa cgccgcgaaa tcaagctgct cctgctgggc accagcaact caggcaagag caccatcgtc aaacagatga agatcatcca cagcggcggc ttcaacctgg aggcctgcaa ggagtacaag cccctcatca tctacaatgc catcgactcg ctgacccgca tcatccgggc cctggccgcc ctcaggatcg acttccacaa ccccgaccgc gcctacgacg ctgtgcagct ctttgcgctg acgggccccg ctgagagcaa gggcgagatc acacccgagc tgctgggtgt catgcgacgg ctctgggccg accaaggggc acaggcctgc ttcagccgct ccagcgagta ccacctggag gacaacgcgg cctactacct gaacgacctg gagcgcatcg ccgcagctga ctatatcccc actgtcgagg acatcctgcg ctcccgggac atgaccacgg gcattgtgga gaacaagttc accttcaagg agctcacctt caagatggtg gacgtggggg ggcagaggtc agagcgcaaa aagtggatcc actgcttcga gggcgtcaca gccatcatct tctgtgtgga gctcagcggc tacgacctga aactctacga ggataaccag acaagtcgga tggcagagag cttgcgcctc tttgactcca tctgcaacaa caactggttc atcaacacct cactcatcct cttcctgaac aagaaggacc tgctggcaga gaagatccgc cgcatcccgc tcaccatctg ctttcccgag tacaagggcc agaacacgta cgaggaggcc gctgtctaca tccagcggca gtttgaagac ctgaaccgca acaaggagac caaggagatc tactcccact tcacctgcgc caccgacacc agtaacatcc agtttgtctt cgacgcggtg acagacgtca tcatacagaa caatctcaag tacattggcc tttgctga. It is sometimes possible for the material contained within the vial of "GNAZ, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual