Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNAS cdna clone

GNAS cDNA Clone

Gene Names
GNAS; AHO; GSA; GSP; POH; GPSA; NESP; SCG6; SgVI; GNAS1; C20orf45
Synonyms
GNAS; GNAS cDNA Clone; GNAS cdna clone
Ordering
For Research Use Only!
Sequence
atgggctgcctcgggaacagtaagaccgaggaccagcgcaacgaggagaaggcgcagcgtgaggccaacaaaaagatcgagaagcagctgcagaaggacaagcaggtctaccgggccacgcaccgcctgctgctgctgggtgctggagaatctggtaaaagcaccattgtgaagcagatgaggatcctgcatgttaatgggtttaatggagagggcggcgaagaggacccgcaggctgcaaggagcaacagcgatggtgagaaggcaaccaaagtgcaggacatcaaaaacaacctgaaagaggcgattgaaaccattgtggccgccatgagcaacctggtgccccccgtggagctggccaaccccgagaaccagttcagagtggactacattctgagtgtgatgaacgtgcctgactttgacttccctcccgaattctatgagcatgccaaggctctgtgggaggatgaaggagtgcgtgcctgctacgaacgctccaacgagtaccagctgattgactgtgcccagtacttcctggacaagatcgacgtgatcaagcaggctgactatgtgccgagcgatcaggacctgcttcgctgccgtgtcctgacttctggaatctttgagaccaagttccaggtggacaaagtcaacttccacatgtttgacgtgggtggccagcgcgatgaacgccgcaagtggatccagtgcttcaacgatgtgactgccatcatcttcgtggtggccagcagcagctacaacatggtcatccgggaggacaaccagaccaaccgcctgcaggaggctctgaacctcttcaagagcatctggaacaacagatggctgcgcaccatctctgtgatcctgttcctcaacaagcaagatctgctcgctgagaaagtccttgctgggaaatcgaagattgaggactactttccagaatttgctcgctacactactcctgaggatgctactcccgagcccggagaggacccacgcgtgacccgggccaagtacttcattcgagatgagtttctgaggatcagcactgccagtggagatgggcgtcactactgctaccctcatttcacctgcgctgtggacactgagaacatccgccgtgtgttcaacgactgccgtgacatcattcagcgcatgcaccttcgtcagtacgagctgctctaa
Sequence Length
1185
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
111,025 Da
NCBI Official Full Name
Homo sapiens GNAS complex locus, mRNA
NCBI Official Synonym Full Names
GNAS complex locus
NCBI Official Symbol
GNAS
NCBI Official Synonym Symbols
AHO; GSA; GSP; POH; GPSA; NESP; SCG6; SgVI; GNAS1; C20orf45
NCBI Protein Information
protein ALEX; protein GNAS; protein SCG6 (secretogranin VI)
UniProt Protein Name
Guanine nucleotide-binding protein G(s) subunit alpha isoforms short
Protein Family
UniProt Gene Name
GNAS
UniProt Synonym Gene Names
GNAS1; GSP
UniProt Entry Name
GNAS2_HUMAN

NCBI Description

This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. An antisense transcript is produced from an overlapping locus on the opposite strand. One of the transcripts produced from this locus, and the antisense transcript, are paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene result in pseudohypoparathyroidism type 1a, pseudohypoparathyroidism type 1b, Albright hereditary osteodystrophy, pseudopseudohypoparathyroidism, McCune-Albright syndrome, progressive osseus heteroplasia, polyostotic fibrous dysplasia of bone, and some pituitary tumors. [provided by RefSeq, Aug 2012]

Uniprot Description

G-alpha(s): a guanine nucleotide-binding protein of the G12 class of G-alpha proteins. Agonist binding to Gq-coupled receptors may block Akt activation via the release of active G-alpha(q) subunits that inhibit phosphatidylinositol 3-kinase. Heterotrimeric G proteins are composed of 3 units; alpha, beta and gamma. The alpha chain contains the guanine nucleotide binding site.

Protein type: G protein; G protein, heterotrimeric; G protein, heterotrimeric alpha G(s); Membrane protein, peripheral; Oncoprotein; Vesicle

Chromosomal Location of Human Ortholog: 20q13.3

Cellular Component: cytosol; membrane

Molecular Function: beta-2 adrenergic receptor binding; corticotropin-releasing hormone receptor 1 binding; D1 dopamine receptor binding; insulin-like growth factor receptor binding; ionotropic glutamate receptor binding; mu-type opioid receptor binding; protein binding

Biological Process: cognition; developmental growth; dopamine receptor, adenylate cyclase activating pathway; G-protein signaling, adenylate cyclase activating pathway; sensory perception of chemical stimulus

Disease: Acth-independent Macronodular Adrenal Hyperplasia; Mccune-albright Syndrome; Osseous Heteroplasia, Progressive; Pituitary Adenoma, Growth Hormone-secreting; Pseudohypoparathyroidism, Type Ia; Pseudohypoparathyroidism, Type Ib; Pseudohypoparathyroidism, Type Ic; Pseudopseudohypoparathyroidism

Research Articles on GNAS

Similar Products

Product Notes

The GNAS gnas (Catalog #AAA1272083) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctgcc tcgggaacag taagaccgag gaccagcgca acgaggagaa ggcgcagcgt gaggccaaca aaaagatcga gaagcagctg cagaaggaca agcaggtcta ccgggccacg caccgcctgc tgctgctggg tgctggagaa tctggtaaaa gcaccattgt gaagcagatg aggatcctgc atgttaatgg gtttaatgga gagggcggcg aagaggaccc gcaggctgca aggagcaaca gcgatggtga gaaggcaacc aaagtgcagg acatcaaaaa caacctgaaa gaggcgattg aaaccattgt ggccgccatg agcaacctgg tgccccccgt ggagctggcc aaccccgaga accagttcag agtggactac attctgagtg tgatgaacgt gcctgacttt gacttccctc ccgaattcta tgagcatgcc aaggctctgt gggaggatga aggagtgcgt gcctgctacg aacgctccaa cgagtaccag ctgattgact gtgcccagta cttcctggac aagatcgacg tgatcaagca ggctgactat gtgccgagcg atcaggacct gcttcgctgc cgtgtcctga cttctggaat ctttgagacc aagttccagg tggacaaagt caacttccac atgtttgacg tgggtggcca gcgcgatgaa cgccgcaagt ggatccagtg cttcaacgat gtgactgcca tcatcttcgt ggtggccagc agcagctaca acatggtcat ccgggaggac aaccagacca accgcctgca ggaggctctg aacctcttca agagcatctg gaacaacaga tggctgcgca ccatctctgt gatcctgttc ctcaacaagc aagatctgct cgctgagaaa gtccttgctg ggaaatcgaa gattgaggac tactttccag aatttgctcg ctacactact cctgaggatg ctactcccga gcccggagag gacccacgcg tgacccgggc caagtacttc attcgagatg agtttctgag gatcagcact gccagtggag atgggcgtca ctactgctac cctcatttca cctgcgctgt ggacactgag aacatccgcc gtgtgttcaa cgactgccgt gacatcattc agcgcatgca ccttcgtcag tacgagctgc tctaa. It is sometimes possible for the material contained within the vial of "GNAS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.