Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNAO1 cdna clone

GNAO1 cDNA Clone

Gene Names
GNAO1; GNAO; EIEE17; HLA-DQB1; G-ALPHA-o
Synonyms
GNAO1; GNAO1 cDNA Clone; GNAO1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagatcatccatgaagatggcttctccggagaagacgtgaaacagtacaagcctgttgtctacagcaacactatccagtccctggcagccatcgtccgggccatggacactttgggcatcgaatatggtgataaggagagaaaggctgacgccaagatggtgtgtgatgtggtgagtcggatggaagacaccgagcccttctctgcagagctgctttctgccatgatgcggctctggggcgactcaggaatccaagagtgcttcaaccggtcccgggagtatcagctcaacgactctgccaaatactacctggacagcctggatcggattggggccgccgactaccagcccaccgagcaggacatcctccgaaccagggtcaaaaccactggcatcgtagaaacccacttcacattcaagaacctccacttcaggctgtttgacgtcggaggccagcgatctgaacgcaagaagtggatccattgcttcgaggacgtcacggccatcattttctgtgtcgcgctcagcggctatgaccaggtgctccacgaagacgaaaccacgaaccgcatgcacgagtctctcatgctcttcgactccatctgtaacaacaagttcttcatcgatacctccatcattctcttcctcaacaagaaagatctctttggcgagaagatcaagaagtcacctttgaccatctgctttcctgaatacacaggccccaatacctatgaagacgcagccgcctacatccaagcacaatttgaaagcaaaaaccgctcacccaacaaagaaatatattgtcacatgacttgtgccacagacacgaataacatccaggtggtgttcgacgccgtcaccgacatcatcattgccaacaacctccggggctgcggcttgtactga
Sequence Length
909
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,087 Da
NCBI Official Full Name
Homo sapiens guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O, mRNA
NCBI Official Synonym Full Names
G protein subunit alpha o1
NCBI Official Symbol
GNAO1
NCBI Official Synonym Symbols
GNAO; EIEE17; HLA-DQB1; G-ALPHA-o
NCBI Protein Information
guanine nucleotide-binding protein G(o) subunit alpha
UniProt Protein Name
Guanine nucleotide-binding protein G(o) subunit alpha
UniProt Gene Name
GNAO1
UniProt Entry Name
GNAO_HUMAN

NCBI Description

The protein encoded by this gene represents the alpha subunit of the Go heterotrimeric G-protein signal-transducing complex. Defects in this gene are a cause of early-onset epileptic encephalopathy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]

Uniprot Description

G-alpha(o): Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems. The G(o) protein function is not clear. Stimulated by RGS14. Interacts with RGS14. G proteins are composed of 3 units; alpha, beta and gamma. The alpha chain contains the guanine nucleotide binding site. Belongs to the G-alpha family. G(i/o/t/z) subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: G protein; G protein, heterotrimeric; G protein, heterotrimeric alpha G((i/o/t/z))

Chromosomal Location of Human Ortholog: 16q13

Cellular Component: heterotrimeric G-protein complex; plasma membrane

Molecular Function: corticotropin-releasing hormone receptor 1 binding; G-protein beta/gamma-subunit binding; GTP binding; GTPase activity; metabotropic serotonin receptor binding; mu-type opioid receptor binding; signal transducer activity

Biological Process: dopamine receptor signaling pathway; G-protein signaling, coupled to cAMP nucleotide second messenger; muscle contraction; protein folding; Wnt receptor signaling pathway, calcium modulating pathway

Disease: Epileptic Encephalopathy, Early Infantile, 17

Research Articles on GNAO1

Similar Products

Product Notes

The GNAO1 gnao1 (Catalog #AAA1275265) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagatca tccatgaaga tggcttctcc ggagaagacg tgaaacagta caagcctgtt gtctacagca acactatcca gtccctggca gccatcgtcc gggccatgga cactttgggc atcgaatatg gtgataagga gagaaaggct gacgccaaga tggtgtgtga tgtggtgagt cggatggaag acaccgagcc cttctctgca gagctgcttt ctgccatgat gcggctctgg ggcgactcag gaatccaaga gtgcttcaac cggtcccggg agtatcagct caacgactct gccaaatact acctggacag cctggatcgg attggggccg ccgactacca gcccaccgag caggacatcc tccgaaccag ggtcaaaacc actggcatcg tagaaaccca cttcacattc aagaacctcc acttcaggct gtttgacgtc ggaggccagc gatctgaacg caagaagtgg atccattgct tcgaggacgt cacggccatc attttctgtg tcgcgctcag cggctatgac caggtgctcc acgaagacga aaccacgaac cgcatgcacg agtctctcat gctcttcgac tccatctgta acaacaagtt cttcatcgat acctccatca ttctcttcct caacaagaaa gatctctttg gcgagaagat caagaagtca cctttgacca tctgctttcc tgaatacaca ggccccaata cctatgaaga cgcagccgcc tacatccaag cacaatttga aagcaaaaac cgctcaccca acaaagaaat atattgtcac atgacttgtg ccacagacac gaataacatc caggtggtgt tcgacgccgt caccgacatc atcattgcca acaacctccg gggctgcggc ttgtactga. It is sometimes possible for the material contained within the vial of "GNAO1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.