Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNAI3 cdna clone

GNAI3 cDNA Clone

Gene Names
GNAI3; 87U6; ARCND1
Synonyms
GNAI3; GNAI3 cDNA Clone; GNAI3 cdna clone
Ordering
For Research Use Only!
Sequence
atgggctgcacgttgagcgccgaagacaaggcggcagtggagcgaagcaagatgatcgaccgcaacttacgggaggacggggaaaaagcggccaaagaagtgaagctgctgctactcggtgctggagaatctggtaaaagcaccattgtgaaacagatgaaaatcattcatgaggatggctattcagaggatgaatgtaaacaatataaagtagttgtctacagcaatactatacagtccatcattgcaatcataagagccatgggacggctaaagattgactttggggaagctgccagggcagatgatgcccggcaattatttgttttagctggcagtgctgaagaaggagtcatgactccagaactagcaggagtgattaaacggttatggcgagatggtggggtacaagcttgcttcagcagatccagggaatatcagctcaatgattctgcttcatattatctaaatgatctggatagaatatcccagtctaactacattccaactcagcaagatgttcttcggacgagagtgaagaccacaggcattgtagaaacacatttcaccttcaaagacctatacttcaagatgtttgatgtaggtggccaaagatcagaacgaaaaaagtggattcactgttttgagggagtgacagcaattatcttctgtgtggccctcagtgattatgaccttgttctggctgaggacgaggagatgaaccgaatgcatgaaagcatgaaactgtttgacagcatttgtaataacaaatggtttacagaaacttcaatcattctcttccttaacaagaaagacctttttgaggaaaaaataaagaggagtccgttaactatctgttatccagaatacacaggttccaatacatatgaagaggcagctgcctatattcaatgccagtttgaagatctgaacagaagaaaagataccaaggagatctatactcacttcacctgtgccacagacacgaagaatgtgcagtttgtttttgatgctgttacagatgtcatcattaaaaacaacttaaaggaatgtggactttattga
Sequence Length
1065
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,532 Da
NCBI Official Full Name
Homo sapiens guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3, mRNA
NCBI Official Synonym Full Names
G protein subunit alpha i3
NCBI Official Symbol
GNAI3
NCBI Official Synonym Symbols
87U6; ARCND1
NCBI Protein Information
guanine nucleotide-binding protein G(k) subunit alpha
UniProt Protein Name
Guanine nucleotide-binding protein G(k) subunit alpha
UniProt Gene Name
GNAI3
UniProt Entry Name
GNAI3_HUMAN

NCBI Description

Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling pathways. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes an alpha subunit and belongs to the G-alpha family. Mutation in this gene, resulting in a gly40-to-arg substitution, is associated with auriculocondylar syndrome, and shown to affect downstream targets in the G protein-coupled endothelin receptor pathway. [provided by RefSeq, Jun 2012]

Uniprot Description

G-alpha i3: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems. G(k) is the stimulatory G protein of receptor- regulated K(+) channels. The active GTP-bound form prevents the association of RGS14 with centrosomes and is required for the translocation of RGS14 from the cytoplasm to the plasma membrane. May play a role in cell division. Defects in GNAI3 are the cause of auriculocondylar syndrome 1 (ARCND1). ARCND1 is an autosomal dominant craniofacial malformation syndrome characterized by variable mandibular anomalies, including mild to severe micrognathia, temporomandibular joint ankylosis, cleft palate, and a characteristic ear malformation that consists of separation of the lobule from the external ear, giving the appearance of a question mark (question-mark ear). Other frequently described features include prominent cheeks, cupped and posteriorly rotated ears, preauricular tags, and microstomia. Belongs to the G-alpha family. G(i/o/t/z) subfamily.

Protein type: G protein, heterotrimeric alpha G((i/o/t/z)); G protein; G protein, heterotrimeric

Chromosomal Location of Human Ortholog: 1p13

Cellular Component: centrosome; cytoplasm; heterotrimeric G-protein complex; lysosomal membrane; membrane; midbody; plasma membrane

Molecular Function: G-protein beta/gamma-subunit binding; G-protein-coupled receptor binding; GDP binding; GTP binding; GTPase activity; protein binding; signal transducer activity

Biological Process: cell division; dopamine receptor signaling pathway; G-protein signaling, adenylate cyclase inhibiting pathway; GTP metabolic process; negative regulation of adenylate cyclase activity; protein folding

Disease: Auriculocondylar Syndrome 1

Research Articles on GNAI3

Similar Products

Product Notes

The GNAI3 gnai3 (Catalog #AAA1277512) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctgca cgttgagcgc cgaagacaag gcggcagtgg agcgaagcaa gatgatcgac cgcaacttac gggaggacgg ggaaaaagcg gccaaagaag tgaagctgct gctactcggt gctggagaat ctggtaaaag caccattgtg aaacagatga aaatcattca tgaggatggc tattcagagg atgaatgtaa acaatataaa gtagttgtct acagcaatac tatacagtcc atcattgcaa tcataagagc catgggacgg ctaaagattg actttgggga agctgccagg gcagatgatg cccggcaatt atttgtttta gctggcagtg ctgaagaagg agtcatgact ccagaactag caggagtgat taaacggtta tggcgagatg gtggggtaca agcttgcttc agcagatcca gggaatatca gctcaatgat tctgcttcat attatctaaa tgatctggat agaatatccc agtctaacta cattccaact cagcaagatg ttcttcggac gagagtgaag accacaggca ttgtagaaac acatttcacc ttcaaagacc tatacttcaa gatgtttgat gtaggtggcc aaagatcaga acgaaaaaag tggattcact gttttgaggg agtgacagca attatcttct gtgtggccct cagtgattat gaccttgttc tggctgagga cgaggagatg aaccgaatgc atgaaagcat gaaactgttt gacagcattt gtaataacaa atggtttaca gaaacttcaa tcattctctt ccttaacaag aaagaccttt ttgaggaaaa aataaagagg agtccgttaa ctatctgtta tccagaatac acaggttcca atacatatga agaggcagct gcctatattc aatgccagtt tgaagatctg aacagaagaa aagataccaa ggagatctat actcacttca cctgtgccac agacacgaag aatgtgcagt ttgtttttga tgctgttaca gatgtcatca ttaaaaacaa cttaaaggaa tgtggacttt attga. It is sometimes possible for the material contained within the vial of "GNAI3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.