GNAI1 cdna clone

GNAI1 cDNA Clone

Cat. Num. AAA1275890

• Gene Names: GNAI1; Gi
• Synonyms: GNAI1; GNAI1 cDNA Clone; GNAI1 cdna clone

• Sequence: atgggctgcacgctgagcgccgaggacaaggcggcggtggagcggagtaagatgatcgaccgcaacctccgtgaggacggcgagaaggcggcgcgcgaggtcaagctgctgctgctcggtgctggtgaatctggtaaaagtacaattgtgaagcagatgaaaattatccatgaagctggttattcagaagaggagtgtaaacaatacaaagcagtggtctacagtaacaccatccagtcaattattgctatcattagggctatggggaggttgaagatagactttggtgactcagcccgggcggatgatgcacgccaactctttgtgctagctggagctgctgaagaaggctttatgactgcagaacttgctggagttataaagagattgtggaaagatagtggtgtacaagcctgtttcaacagatcccgagagtaccagcttaatgattctgcagcatactatttgaatgacttggacagaatagctcaaccaaattacatcccgactcaacaagatgttctcagaactagagtgaaaactacaggaattgttgaaacccattttactttcaaagatcttcattttaaaatgtttgatgtgggaggtcagagatctgagcggaagaagtggattcattgcttcgaaggagtggcggcgatcatcttctgtgtagcactgagtgactacgacctggttctagctgaagatgaagaaatgaaccgaatgcatgaaagcatgaaattgtttgacagcatatgtaacaacaagtggtttacagatacatccattatactttttctaaacaagaaggatctttttgaagaaaaaatcaaaaagagccctctcactatatgctatcaagaatatgcaggatcaaacacatatgaagaggcagctgcatatattcaatgtcagtttgaagacctcaataaaagaaaggacacaaaggaaatatacacccacttcacatgtgccacagatactaagaatgtgcagtttgtttttgatgctgtaacagatgtcatcataaaaaataatctaaaagattgtggtctcttttaa
• Sequence Length: 1065

• Vector: pENTR223.1 or pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 20072862
• NCBI GeneID: 2770
• Molecular Weight: 34,775 Da
• NCBI Official Full Name: Homo sapiens guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1, mRNA
• NCBI Official Synonym Full Names: G protein subunit alpha i1
• NCBI Official Symbol: GNAI1
• NCBI Official Synonym Symbols: Gi
• NCBI Protein Information: guanine nucleotide-binding protein G(i) subunit alpha-1
• UniProt Protein Name: Guanine nucleotide-binding protein G(i) subunit alpha-1
• UniProt Gene Name: GNAI1
• UniProt Entry Name: GNAI1_HUMAN

NCBI Description

Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]

Uniprot Description

G-alpha i1: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems. The G(i) proteins are involved in hormonal regulation of adenylate cyclase: they inhibit the cyclase in response to beta-adrenergic stimuli. The inactive GDP-bound form prevents the association of RGS14 with centrosomes and is required for the translocation of RGS14 from the cytoplasm to the plasma membrane. May play a role in cell division. Interacts with GPSM1. Interacts with RGS12. Interacts (via active GTP- or inactive GDP-bound forms) with RGS14 (via RGS and GoLoco domains); the interaction occurs in the centrosomes. Interacts (GDP-bound form) with RIC8A (via C-terminus). Interacts with DRD2. G proteins are composed of 3 units; alpha, beta and gamma. The alpha chain contains the guanine nucleotide binding site. Belongs to the G-alpha family. G(i/o/t/z) subfamily.

Protein type: G protein; G protein, heterotrimeric; G protein, heterotrimeric alpha G((i/o/t/z))

Chromosomal Location of Human Ortholog: 7q21

Cellular Component: centrosome; cytoplasm; heterotrimeric G-protein complex; lysosomal membrane; midbody; plasma membrane

Molecular Function: G-protein beta/gamma-subunit binding; G-protein-coupled receptor binding; GDP binding; GTP binding; GTPase activity; magnesium ion binding; metabotropic serotonin receptor binding; protein binding; signal transducer activity

Biological Process: cell division; G-protein coupled receptor protein signaling pathway; G-protein signaling, adenylate cyclase inhibiting pathway; G-protein signaling, coupled to cAMP nucleotide second messenger; protein folding; response to peptide hormone stimulus