Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNA11 cdna clone

GNA11 cDNA Clone

Gene Names
GNA11; FBH; FBH2; FHH2; HHC2; GNA-11; HYPOC2
Synonyms
GNA11; GNA11 cDNA Clone; GNA11 cdna clone
Ordering
For Research Use Only!
Sequence
atggatcgcctgtgctgccttcgcccgccgccacaccgggaccctgcacggctgcttctggcctcgacagatgacaaaagaaacagccccaaaatacgaccactccaaccagcagttcccgcctgcctgcccgccactgtcaggcctgccctggcctcctcgtccgcagggctgtctgctggcttctgggggcagaagagcggggagccccgtggaagggtcaggggagaccaggtcagggcagctacatttctggtgatcagccccatggggagacggggctggcgggataccgcccccccggcttccccacaccacttctgtctcacccggaagcgtcctttttttgtgccaggtgtctacctaagagggttggtgccagaagccccccatggcgagtgctggggcccggcggtgccctgggggagcagatggggccacccctggcagggccgctacaactttttccagcagcggagccctctggggggcctgtgcttgtggcatctctga
Sequence Length
513
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,123 Da
NCBI Official Full Name
Homo sapiens guanine nucleotide binding protein (G protein), alpha 11 (Gq class), mRNA
NCBI Official Synonym Full Names
G protein subunit alpha 11
NCBI Official Symbol
GNA11
NCBI Official Synonym Symbols
FBH; FBH2; FHH2; HHC2; GNA-11; HYPOC2
NCBI Protein Information
guanine nucleotide-binding protein subunit alpha-11
UniProt Protein Name
Guanine nucleotide-binding protein subunit alpha-11
UniProt Gene Name
GNA11
UniProt Synonym Gene Names
GA11; G alpha-11; G-protein subunit alpha-11
UniProt Entry Name
GNA11_HUMAN

NCBI Description

The protein encoded by this gene belongs to the family of guanine nucleotide-binding proteins (G proteins), which function as modulators or transducers in various transmembrane signaling systems. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes one of the alpha subunits (subunit alpha-11). Mutations in this gene have been associated with hypocalciuric hypercalcemia type II (HHC2) and hypocalcemia dominant 2 (HYPOC2). Patients with HHC2 and HYPOC2 exhibit decreased or increased sensitivity, respectively, to changes in extracellular calcium concentrations. [provided by RefSeq, Dec 2013]

Uniprot Description

G-alpha 11: a guanine nucleotide-binding protein of the G-alpha family. Acts as an activator of phospholipase C. Involved in signaling of gonadotropin-releasing hormone receptor, negatively regulating cell growth. Down-regulation may be involved in human breast cancers. Heterotrimeric G proteins are composed of 3 units; alpha, beta and gamma. The alpha chain contains the guanine nucleotide binding site.

Protein type: G protein; G protein, heterotrimeric; G protein, heterotrimeric alpha G(q)

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: cytoplasm; lysosomal membrane; photoreceptor outer segment; plasma membrane

Molecular Function: GTPase activity; type 2A serotonin receptor binding

Biological Process: acetylcholine receptor signaling, muscarinic pathway; dopamine receptor, phospholipase C activating pathway; entrainment of circadian clock; phototransduction, visible light; platelet activation; regulation of action potential; signal transduction

Disease: Hypocalciuric Hypercalcemia, Familial, Type Ii

Research Articles on GNA11

Similar Products

Product Notes

The GNA11 gna11 (Catalog #AAA1276468) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatcgcc tgtgctgcct tcgcccgccg ccacaccggg accctgcacg gctgcttctg gcctcgacag atgacaaaag aaacagcccc aaaatacgac cactccaacc agcagttccc gcctgcctgc ccgccactgt caggcctgcc ctggcctcct cgtccgcagg gctgtctgct ggcttctggg ggcagaagag cggggagccc cgtggaaggg tcaggggaga ccaggtcagg gcagctacat ttctggtgat cagccccatg gggagacggg gctggcggga taccgccccc ccggcttccc cacaccactt ctgtctcacc cggaagcgtc ctttttttgt gccaggtgtc tacctaagag ggttggtgcc agaagccccc catggcgagt gctggggccc ggcggtgccc tgggggagca gatggggcca cccctggcag ggccgctaca actttttcca gcagcggagc cctctggggg gcctgtgctt gtggcatctc tga. It is sometimes possible for the material contained within the vial of "GNA11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.