Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GLYCTK cdna clone

GLYCTK cDNA Clone

Gene Names
GLYCTK; HBEBP2; HBEBP4; HBeAgBP4A
Synonyms
GLYCTK; GLYCTK cDNA Clone; GLYCTK cdna clone
Ordering
For Research Use Only!
Sequence
atggctgcagccctgcaggtcctgccccgcttggcccgagcccccttgcatccactcctctggcggggctcagtggcccgtctggccagcagcatggccttggcagagcaggccaggcagctgtttgagagtgctgtaggtgcagtgctgccgggccccatgctgcaccgggcactatccttggaccctggtggcagacagctgaaggtgcgggaccggaactttcagctgaggcaaaacctctacctggtgggctttggcaaggctgtgctgggtatggcagctgcagctgaggaactactgggccagcatcttgtgcagggcgtgatcagcgttcccaaggggatccgtgctgccatggagcgtgccggcaagcaggagatgctgctgaagccacatagccgtgtccaggtattcgagggtgcggaggacaacctcccggaccgcgatgcgctgcgggctgcactggccatccagcaactggctgagggactcacagctgatgacctgctgctcgtgctgatctcaggtgggggttcagctctgctgcctgcccccatcccacctgtcacactggaggagaagcagacactcactagactgctggcagcccgtggagccaccatccaggagttgaacaccattcggaaggccctgtcccagctcaagggtggggggctggctcaggccgcctaccctgcccaggtggtgagcctcatcctgtcagatgtggtgggggaccctgtggaggtgattgccagtggccccaccgtggccagttcccacaatgtgcaagattgcctgcatatcctcaatcgctacggcctccgtgcagccctgccacgttctgtgaagactgtgctgtctcgggccgactctgacccccatgggccacacacctgtggccatgtcctgaatgtgatcattggctctaatgtgctggcgctagctgaggcccagcggcaggccgaggcactgggctaccaggctgtggtgctgagtgcagccatgcaaggtgatgtaaaaagtatggcccagttctacgggctgctggcccatgtggctagaacccgcctcaccccatccatggctggggcttctgtggaggaagatgcacagctccatgagctggcagctgagcttcagatcccagacctgcagctggaggaggctctggagaccatggcatggggaaggggcccagtctgcctgctggctggtggcgagcccacagtacagctgcagggctcgggcaggggtggccggaaccaggaactggccctgcgtgttggagcagagttgagaaggtggccgctggggccgatagatgtgctgtttttgagcggtggcaccgatgggcaggatgggcccacagaggctgctggggcctgggtcacacctgagcttgccagccaggctgcagctgagggcctggacatagccaccttcctagcccacaatgactcacataccttcttctgctgcctccagggtggggcacacctgctgcacacagggatgacaggtaccaatgtcatggacacccacctcttgttcctgcggcctcggtga
Sequence Length
1572
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,027 Da
NCBI Official Full Name
Homo sapiens glycerate kinase, mRNA
NCBI Official Synonym Full Names
glycerate kinase
NCBI Official Symbol
GLYCTK
NCBI Official Synonym Symbols
HBEBP2; HBEBP4; HBeAgBP4A
NCBI Protein Information
glycerate kinase
UniProt Protein Name
Glycerate kinase
UniProt Gene Name
GLYCTK
UniProt Synonym Gene Names
HBEBP4
UniProt Entry Name
GLCTK_HUMAN

NCBI Description

This locus encodes a member of the glycerate kinase type-2 family. The encoded enzyme catalyzes the phosphorylation of (R)-glycerate and may be involved in serine degradation and fructose metabolism. Decreased activity of the encoded enzyme may be associated with the disease D-glyceric aciduria. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]

Uniprot Description

GLYCTK: Defects in GLYCTK are the cause of D-glyceric aciduria (D-GA). D-GA is a rare metabolic disease characterized by chronic metabolic acidosis and a highly variable clinical phenotype. Clinical features range from an encephalopathic presentation with seizures, microcephaly, severe mental retardation and early death, to milder manifestations with only speech delay or even normal development. Belongs to the glycerate kinase type-2 family. 7 isoforms of the human protein are produced by alternative splicing.

Protein type: Carbohydrate Metabolism - glyoxylate and dicarboxylate; EC 2.7.1.31; Amino Acid Metabolism - glycine, serine and threonine; Lipid Metabolism - glycerolipid; Kinase, other

Chromosomal Location of Human Ortholog: 3p21.1

Cellular Component: cytoplasm; cytosol

Molecular Function: glycerate kinase activity; protein binding

Biological Process: protein amino acid phosphorylation

Disease: D-glyceric Aciduria

Research Articles on GLYCTK

Similar Products

Product Notes

The GLYCTK glyctk (Catalog #AAA1277057) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcag ccctgcaggt cctgccccgc ttggcccgag cccccttgca tccactcctc tggcggggct cagtggcccg tctggccagc agcatggcct tggcagagca ggccaggcag ctgtttgaga gtgctgtagg tgcagtgctg ccgggcccca tgctgcaccg ggcactatcc ttggaccctg gtggcagaca gctgaaggtg cgggaccgga actttcagct gaggcaaaac ctctacctgg tgggctttgg caaggctgtg ctgggtatgg cagctgcagc tgaggaacta ctgggccagc atcttgtgca gggcgtgatc agcgttccca aggggatccg tgctgccatg gagcgtgccg gcaagcagga gatgctgctg aagccacata gccgtgtcca ggtattcgag ggtgcggagg acaacctccc ggaccgcgat gcgctgcggg ctgcactggc catccagcaa ctggctgagg gactcacagc tgatgacctg ctgctcgtgc tgatctcagg tgggggttca gctctgctgc ctgcccccat cccacctgtc acactggagg agaagcagac actcactaga ctgctggcag cccgtggagc caccatccag gagttgaaca ccattcggaa ggccctgtcc cagctcaagg gtggggggct ggctcaggcc gcctaccctg cccaggtggt gagcctcatc ctgtcagatg tggtggggga ccctgtggag gtgattgcca gtggccccac cgtggccagt tcccacaatg tgcaagattg cctgcatatc ctcaatcgct acggcctccg tgcagccctg ccacgttctg tgaagactgt gctgtctcgg gccgactctg acccccatgg gccacacacc tgtggccatg tcctgaatgt gatcattggc tctaatgtgc tggcgctagc tgaggcccag cggcaggccg aggcactggg ctaccaggct gtggtgctga gtgcagccat gcaaggtgat gtaaaaagta tggcccagtt ctacgggctg ctggcccatg tggctagaac ccgcctcacc ccatccatgg ctggggcttc tgtggaggaa gatgcacagc tccatgagct ggcagctgag cttcagatcc cagacctgca gctggaggag gctctggaga ccatggcatg gggaaggggc ccagtctgcc tgctggctgg tggcgagccc acagtacagc tgcagggctc gggcaggggt ggccggaacc aggaactggc cctgcgtgtt ggagcagagt tgagaaggtg gccgctgggg ccgatagatg tgctgttttt gagcggtggc accgatgggc aggatgggcc cacagaggct gctggggcct gggtcacacc tgagcttgcc agccaggctg cagctgaggg cctggacata gccaccttcc tagcccacaa tgactcacat accttcttct gctgcctcca gggtggggca cacctgctgc acacagggat gacaggtacc aatgtcatgg acacccacct cttgttcctg cggcctcggt ga. It is sometimes possible for the material contained within the vial of "GLYCTK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.