Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GLI3 cdna clone

GLI3 cDNA Clone

Gene Names
GLI3; PHS; ACLS; GCPS; PAPA; PAPB; PAP-A; PAPA1; PPDIV; GLI3FL; GLI3-190
Synonyms
GLI3; GLI3 cDNA Clone; GLI3 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggcccagtcccacagctccacgaccactgaaaagaaaaaagttgagaattccatagtgaagtgctccactcgaacagatgtgagcgagaaagccgttgcctccagcaccacttctaatgaggatgaaagtcctggacagacttatcacagagagagaagaaacgcaatcactatgcagccacagaatgtccaggggctcagcaaagtcagtgaggaaccttcaacatcgagtgacgagagggcctcattgatcaagaaagagatccatgggtccctgccacacgtggcggagccctctgtgccgtaccgcgggacggtgtttgccatggaccccaggaatggttacatggagccccactaccaccctcctcatcttttccctgccttccatcctcctgtaccaattgatgccagacatcatgagggccgttaccattacgatccatctccgattcctccattgcatatgacttccgccttatctagtagccctacgtatccggacctgcccttcattaggatctccccacaccggaaccccgctgctgcttccgagtctcccttcagccctccacatccctacattaatccctacatggactatatccgctccttgcacagcagcccatcgctctccatgatctcagcaacccgtgggctgagccctacagatgcgccccatgcaggagtcagcccagcagaatactatcatcagatggccctgctaactggccagcgcagcccctatgcagacattattccctcagctgccaccgccggcacgggggccatccacatggaatatcttcatgctatggatagcaccagattctccagccccaggctgtcagccaggccgagccgaaaacgtacactgtccatatcaccactctccgatcatagctttgaccttcagaccatgataaggacgtctcccaactccttggtcacgattctcaataattcccgtagcagctcttcagcaagtggctcctatggtcacttatctgcaagtgcaatcagccctgccttgagcttcacctactcttccgcgcccgtctctctccacatgcatcagcagatcctaagccgacaacagagcttaggttcagcctttggacacagccctccactcatccaccctgccccaacttttccaacacagaggcctattccagggatccctacggttctgaaccccgtccaggtcagctccggcccttctgagtcctcacagaacaagcccacgagtgagtctgcagtgagcagcactggtgacccgatgcacaacaagaggtccaagatcaaacccgatgaagacctccccagcccaggggctcgggggcagcaggaacagcccgaaggaacaacccttgtcaaggaggaaggggacaaagatgaaagcaaacaggagcctgaagtcatctatgagacaaactgccactgggaaggctgcgcgagggagttcgacacccaagagcagcttgtgcaccatataaataacgaccatattcatggagagaagaaggagttcgtgtgcaggtggctggactgctcaagagagcagaaacccttcaaagcccagtatatgttggtagtgcatatgagaagacacacgggcgagaagcctcacaaatgcacttttgaaggttgcacaaaggcctactcgagactagaaaacttgaaaacacacttgagatctcacactggagagaaaccatacgtctgtgagcacgaaggttgcaacaaggctttctcaaatgcctctgatcgcgccaaacaccaaaacagaacgcattccaatgagaaaccatatgtgtgcaaaatcccaggctgcactaagcgttacacagacccaagctccctccggaaacatgtgaagacagtgcatggcccagaggctcatgtcaccaagaagcagcgaggggacatccatcctcggccgccacccccgagagattccggcagccattcacagtccaggtcgcctggccgaccgactcagggagcccttggtgagcagcaggacctcagcaacactacctcaaagcgggaagaatgcctccaggtgaaaaccgtcaaggcagagaagccaatgacatctcagccaagccctggtggtcagtcttcatgcagcagccaacagtcccccatcagcaactattccaacagtgggctcgagcttcctctgaccgatggaggtagtataggagacctcagtgccatcgatgaaaccccaatcatggactcaaccatttccactgcaaccacagcccttgctttgcaagccaggagaaacccggcagggaccaaatggatggagcacgtaaaactagaaaggctaaaacaagtgaatggaatgtttccgcgactgaaccccattctaccccctaaagcccctgcggtctctcctctcataggaaatggcacacagtccaacaacacctgcagcttgggtgggcccatgacgcttctcccgggcagaagcgacctctctggggtggacgtcactatgctgaacatgctcaacagaagggacagcagcgccagcaccatcagctcggcctacctgagcagccgccgctcctcagggatctcgccctgcttctccagccgccgctccagcgaggcgtcacaggccgagggccggccgcagaacgtgagcgtggccgactcctacgaccccatctccaccgacgcctcgcgccgctccagcgaagccagccagagcgacggcctgcccagcctgctcagcctcacgcccgcccagcagtaccgcctcaaggccaagtacgcggctgccacaggagggccgccgccgacgcccctgcccaacatggagaggatgagcctgaagacgcgcctggcgctgctcggggatgccctcgagcctggcgtggccctgcctccagttcatgccccgaggaggtgcagcgacgggggagcccacggctacgggcggcgccacctgcagccgcacgatgcgctgggccacggcgtgaggagggccagcgacccggtgcggacaggctccgagggcctggccctgcctcgtgtgccgcgcttcagcagcctcagcagctgcaaccccccggcgatggccacgtccgcggagaagcgcagtctcgtgcttcagaattacacgcggcccgagggcggccagtcccgaaacttccactcgtccccctgtcctcccagcatcaccgagaacgtcaccctggagtccctgaccatggacgctgatgccaacctgaacgatgaggatttcctgccggacgacgtggtgcagtatttaaattcccagaaccaagcagggtacgagcagcacttccccagcgccctcccggacgacagcaaagtgccccacgggcccggtgactttgacgcgcccgggctgccagacagccacgctggccagcagttccatgccctcgagcagccctgccccgagggcagcaaaaccgacctgcccattcagtggaacgaagtcagctccggaagcgccgacctgtcctcctccaagctcaagtgtgggccgcggcccgctgtgccgcagactcgcgcctttgggttctgcaacggcatggtcgtccacccgcagaaccccttgaggagcgggcctgctgggggctatcagaccctcggggagaacagcaacccctacggtggcccagagcacttgatgctccacaacagccccggaagtggcaccagtggaaacgccttccatgaacagccctgtaaggccccgcagtatgggaactgtctcaacaggcagccagtggcccctggtgcactcgacggtgcctgtggtgccgggattcaagcctcaaagctgaagagcacccccatgcaagggagcgggggccagctgaatttcggcctgccggtagcgccaaatgagtcagctggcagcatggtgaatggcatgcagaaccaggacccagtgggacaggggtacctggctcaccagctcctcggcgacagcatgcagcacccgggggcaggccgccccggtcagcagatgcttgggcagattagtgctacctcacacatcaacatctaccaagggccagagagctgcctgccaggggctcacggcatgggcagccagccgtcaagcttggcagttgtcaggggctaccagccatgtgccagctttgggggcagcaggcgccaggctatgccgagggacagccttgctctgcagtcaggacagctcagtgacacaagtcagacctgcagggtgaatggtatcaagatggagatgaaagggcagccccatccgctgtgctctaatctgcagaattactctggtcagttctatgaccaaaccgtgggcttcagtcagcaagacacgaaagctggttcattctctatttcagacgccagctgcctgctacaggggaccagcgccaaaaactctgagttactttccccaggtgctaatcaggtgacaagcacagtggacagcctcgacagccatgacctggaaggggtacagattgacttcgatgccatcatagacgatggggaccactccagcctgatgtcgggggccctgagcccaagtatcattcagaacctttcccatagctcctcccgcctcaccacgcctcgggcgtccctcccattcccagcgctgtccatgagcaccaccaacatggctatcggggacatgagttctttgctgacctccctagcggaagaaagcaaattccttgcagttatgcaatag
Sequence Length
4743
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
169,863 Da
NCBI Official Full Name
Homo sapiens GLI family zinc finger 3, mRNA
NCBI Official Synonym Full Names
GLI family zinc finger 3
NCBI Official Symbol
GLI3
NCBI Official Synonym Symbols
PHS; ACLS; GCPS; PAPA; PAPB; PAP-A; PAPA1; PPDIV; GLI3FL; GLI3-190
NCBI Protein Information
transcriptional activator GLI3
UniProt Protein Name
Transcriptional activator GLI3
Protein Family
UniProt Gene Name
GLI3
UniProt Synonym Gene Names
GLI3-190; GLI3FL; GLI3-83
UniProt Entry Name
GLI3_HUMAN

NCBI Description

This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]

Uniprot Description

GLI3: Has a dual function as a transcriptional activator and a repressor of the sonic hedgehog (Shh) pathway, and plays a role in limb development. The full-length GLI3 form (GLI3FL) after phosphorylation and nuclear translocation, acts as an activator (GLI3A) while GLI3R, its C-terminally truncated form, acts as a repressor. A proper balance between the GLI3 activator and the repressor GLI3R, rather than the repressor gradient itself or the activator/repressor ratio gradient, specifies limb digit number and identity. In concert with TRPS1, plays a role in regulating the size of the zone of distal chondrocytes, in restricting the zone of PTHLH expression in distal cells and in activating chondrocyte proliferation. Binds to the minimal GLI-consensus sequence 5'-GGGTGGTC-3'. Defects in GLI3 are the cause of Greig cephalo-poly- syndactyly syndrome (GCPS). GCPS is an autosomal dominant disorder affecting limb and craniofacial development. It is characterized by pre- and postaxial polydactyly, syndactyly of fingers and toes, macrocephaly and hypertelorism. Defects in GLI3 are a cause of Pallister-Hall syndrome (PHS). PHS is characterized by a wide range of clinical manifestations. It mainly associates central or postaxial polydactyly, syndactyly, and hypothalamic hamartoma. Malformations are frequent in the viscera, e.g. anal atresia, bifid uvula, congenital heart malformations, pulmonary or renal dysplasia. It is an autosomal dominant disorder. Defects in GLI3 are a cause of polydactyly postaxial type A1 (PAPA1). A trait characterized by an extra digit in the ulnar and/or fibular side of the upper and/or lower extremities. The extra digit is well formed and articulates with the fifth, or extra, metacarpal/metatarsal, and thus it is usually functional. Defects in GLI3 are a cause of polydactyly postaxial type B polydactyly (PAPB). A trait characterized by an extra digit in the ulnar and/or fibular side of the upper and/or lower extremities. The extra digit is not well formed and is frequently in the form of a skin. Defects in GLI3 are a cause of polydactyly preaxial type 4 (POP4). Polydactyly preaxial type 4 (i.e. polydactyly on the radial/tibial side of the hand/foot) covers a heterogeneous group of entities. In preaxial polydactyly type IV, the thumb shows only the mildest degree of duplication, and syndactyly of various degrees affects fingers 3 and 4. Belongs to the GLI C2H2-type zinc-finger protein family.

Protein type: Transcription factor; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 7p13

Cellular Component: cilium; cytoplasm; cytosol; nucleoplasm; nucleus; Srb-mediator complex

Molecular Function: beta-catenin binding; histone acetyltransferase binding; histone deacetylase binding; protein binding; transcription factor activity

Biological Process: embryonic digit morphogenesis; embryonic gut development; limb morphogenesis; negative regulation of alpha-beta T cell differentiation; negative regulation of smoothened signaling pathway; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; negative thymic T cell selection; nose morphogenesis; positive regulation of alpha-beta T cell differentiation; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; smoothened signaling pathway; T cell differentiation in the thymus

Disease: Greig Cephalopolysyndactyly Syndrome; Hypothalamic Hamartomas; Pallister-hall Syndrome; Polydactyly, Postaxial, Type A1; Polydactyly, Preaxial Iv; Tracheoesophageal Fistula With Or Without Esophageal Atresia

Research Articles on GLI3

Similar Products

Product Notes

The GLI3 gli3 (Catalog #AAA1277706) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggccc agtcccacag ctccacgacc actgaaaaga aaaaagttga gaattccata gtgaagtgct ccactcgaac agatgtgagc gagaaagccg ttgcctccag caccacttct aatgaggatg aaagtcctgg acagacttat cacagagaga gaagaaacgc aatcactatg cagccacaga atgtccaggg gctcagcaaa gtcagtgagg aaccttcaac atcgagtgac gagagggcct cattgatcaa gaaagagatc catgggtccc tgccacacgt ggcggagccc tctgtgccgt accgcgggac ggtgtttgcc atggacccca ggaatggtta catggagccc cactaccacc ctcctcatct tttccctgcc ttccatcctc ctgtaccaat tgatgccaga catcatgagg gccgttacca ttacgatcca tctccgattc ctccattgca tatgacttcc gccttatcta gtagccctac gtatccggac ctgcccttca ttaggatctc cccacaccgg aaccccgctg ctgcttccga gtctcccttc agccctccac atccctacat taatccctac atggactata tccgctcctt gcacagcagc ccatcgctct ccatgatctc agcaacccgt gggctgagcc ctacagatgc gccccatgca ggagtcagcc cagcagaata ctatcatcag atggccctgc taactggcca gcgcagcccc tatgcagaca ttattccctc agctgccacc gccggcacgg gggccatcca catggaatat cttcatgcta tggatagcac cagattctcc agccccaggc tgtcagccag gccgagccga aaacgtacac tgtccatatc accactctcc gatcatagct ttgaccttca gaccatgata aggacgtctc ccaactcctt ggtcacgatt ctcaataatt cccgtagcag ctcttcagca agtggctcct atggtcactt atctgcaagt gcaatcagcc ctgccttgag cttcacctac tcttccgcgc ccgtctctct ccacatgcat cagcagatcc taagccgaca acagagctta ggttcagcct ttggacacag ccctccactc atccaccctg ccccaacttt tccaacacag aggcctattc cagggatccc tacggttctg aaccccgtcc aggtcagctc cggcccttct gagtcctcac agaacaagcc cacgagtgag tctgcagtga gcagcactgg tgacccgatg cacaacaaga ggtccaagat caaacccgat gaagacctcc ccagcccagg ggctcggggg cagcaggaac agcccgaagg aacaaccctt gtcaaggagg aaggggacaa agatgaaagc aaacaggagc ctgaagtcat ctatgagaca aactgccact gggaaggctg cgcgagggag ttcgacaccc aagagcagct tgtgcaccat ataaataacg accatattca tggagagaag aaggagttcg tgtgcaggtg gctggactgc tcaagagagc agaaaccctt caaagcccag tatatgttgg tagtgcatat gagaagacac acgggcgaga agcctcacaa atgcactttt gaaggttgca caaaggccta ctcgagacta gaaaacttga aaacacactt gagatctcac actggagaga aaccatacgt ctgtgagcac gaaggttgca acaaggcttt ctcaaatgcc tctgatcgcg ccaaacacca aaacagaacg cattccaatg agaaaccata tgtgtgcaaa atcccaggct gcactaagcg ttacacagac ccaagctccc tccggaaaca tgtgaagaca gtgcatggcc cagaggctca tgtcaccaag aagcagcgag gggacatcca tcctcggccg ccacccccga gagattccgg cagccattca cagtccaggt cgcctggccg accgactcag ggagcccttg gtgagcagca ggacctcagc aacactacct caaagcggga agaatgcctc caggtgaaaa ccgtcaaggc agagaagcca atgacatctc agccaagccc tggtggtcag tcttcatgca gcagccaaca gtcccccatc agcaactatt ccaacagtgg gctcgagctt cctctgaccg atggaggtag tataggagac ctcagtgcca tcgatgaaac cccaatcatg gactcaacca tttccactgc aaccacagcc cttgctttgc aagccaggag aaacccggca gggaccaaat ggatggagca cgtaaaacta gaaaggctaa aacaagtgaa tggaatgttt ccgcgactga accccattct accccctaaa gcccctgcgg tctctcctct cataggaaat ggcacacagt ccaacaacac ctgcagcttg ggtgggccca tgacgcttct cccgggcaga agcgacctct ctggggtgga cgtcactatg ctgaacatgc tcaacagaag ggacagcagc gccagcacca tcagctcggc ctacctgagc agccgccgct cctcagggat ctcgccctgc ttctccagcc gccgctccag cgaggcgtca caggccgagg gccggccgca gaacgtgagc gtggccgact cctacgaccc catctccacc gacgcctcgc gccgctccag cgaagccagc cagagcgacg gcctgcccag cctgctcagc ctcacgcccg cccagcagta ccgcctcaag gccaagtacg cggctgccac aggagggccg ccgccgacgc ccctgcccaa catggagagg atgagcctga agacgcgcct ggcgctgctc ggggatgccc tcgagcctgg cgtggccctg cctccagttc atgccccgag gaggtgcagc gacgggggag cccacggcta cgggcggcgc cacctgcagc cgcacgatgc gctgggccac ggcgtgagga gggccagcga cccggtgcgg acaggctccg agggcctggc cctgcctcgt gtgccgcgct tcagcagcct cagcagctgc aaccccccgg cgatggccac gtccgcggag aagcgcagtc tcgtgcttca gaattacacg cggcccgagg gcggccagtc ccgaaacttc cactcgtccc cctgtcctcc cagcatcacc gagaacgtca ccctggagtc cctgaccatg gacgctgatg ccaacctgaa cgatgaggat ttcctgccgg acgacgtggt gcagtattta aattcccaga accaagcagg gtacgagcag cacttcccca gcgccctccc ggacgacagc aaagtgcccc acgggcccgg tgactttgac gcgcccgggc tgccagacag ccacgctggc cagcagttcc atgccctcga gcagccctgc cccgagggca gcaaaaccga cctgcccatt cagtggaacg aagtcagctc cggaagcgcc gacctgtcct cctccaagct caagtgtggg ccgcggcccg ctgtgccgca gactcgcgcc tttgggttct gcaacggcat ggtcgtccac ccgcagaacc ccttgaggag cgggcctgct gggggctatc agaccctcgg ggagaacagc aacccctacg gtggcccaga gcacttgatg ctccacaaca gccccggaag tggcaccagt ggaaacgcct tccatgaaca gccctgtaag gccccgcagt atgggaactg tctcaacagg cagccagtgg cccctggtgc actcgacggt gcctgtggtg ccgggattca agcctcaaag ctgaagagca cccccatgca agggagcggg ggccagctga atttcggcct gccggtagcg ccaaatgagt cagctggcag catggtgaat ggcatgcaga accaggaccc agtgggacag gggtacctgg ctcaccagct cctcggcgac agcatgcagc acccgggggc aggccgcccc ggtcagcaga tgcttgggca gattagtgct acctcacaca tcaacatcta ccaagggcca gagagctgcc tgccaggggc tcacggcatg ggcagccagc cgtcaagctt ggcagttgtc aggggctacc agccatgtgc cagctttggg ggcagcaggc gccaggctat gccgagggac agccttgctc tgcagtcagg acagctcagt gacacaagtc agacctgcag ggtgaatggt atcaagatgg agatgaaagg gcagccccat ccgctgtgct ctaatctgca gaattactct ggtcagttct atgaccaaac cgtgggcttc agtcagcaag acacgaaagc tggttcattc tctatttcag acgccagctg cctgctacag gggaccagcg ccaaaaactc tgagttactt tccccaggtg ctaatcaggt gacaagcaca gtggacagcc tcgacagcca tgacctggaa ggggtacaga ttgacttcga tgccatcata gacgatgggg accactccag cctgatgtcg ggggccctga gcccaagtat cattcagaac ctttcccata gctcctcccg cctcaccacg cctcgggcgt ccctcccatt cccagcgctg tccatgagca ccaccaacat ggctatcggg gacatgagtt ctttgctgac ctccctagcg gaagaaagca aattccttgc agttatgcaa tag. It is sometimes possible for the material contained within the vial of "GLI3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.