Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GK3P cdna clone

GK3P cDNA Clone

Gene Names
GK3P; GKP3; GKTB
Synonyms
GK3P; GK3P cDNA Clone; GK3P cdna clone
Ordering
For Research Use Only!
Sequence
atggcagcctcaaagaaggcagttttggggccattggtgggggcagtggaccaaggcaccagttccacgcgctttttggttttcaattcaagaacagctgaactacttagtcatcatcaagtggaaataaaacaagagttcccaagagaaggatgggtggaacaggaccctaaggaaattctacattctgtctatgagtgtatagagaaaacatgtgagaaacttggacagctcaatattggtatttccaacataaaagctattggtgtcagcaaccagagggaaaccaccgtagtctgggacaagataactggagagcctctctacaatgctgtggtgtggcttgatctaagaacacagtctaccgttgagagtcttagtaaaagaattccaggaaataataactttgtcaagtccaagacaggccttccacttagcacttacttcagtgcagtgaaacttcgctggctcctcgacaatgtgagaaaagttcaaaaggccgttgaagaaaaacgagctctttttgggactattgattcatggcttatttggagtttgacaggaggcgtcaatggaggtgtccactgtacagatgtaacaaatgcaagtaggactatgcttttcaacattcattctttggaatgggataaacaactctgtgaattttttggaattccaatggaaattcttccacatgttcggagttcttctgagatctatggcctaatgaaagcgggggccttggaaggtgtgccaatatctgggtgtttaggggaccagtctgctgcactggtgggacaaatgtgcttccagattggacaagccaaaaatacgtatggaacaggatgtttcttactatgtaatacaggccataagtgtgtattttctgatcatggccttctcaccacagtggcttacaaacttggcagagacaaaccggtatattacgctttggaaggttctgtagctatagctggtgctgttattcgctggctaagagacaatcttggaattataaagacctcagaagaaattgaaaaacttgctaaagaagtaggtacttcttatggctgctacttcgtcccagcattttcggggttatatgcaccttattgggagcccagcgcaagagggataatctgtggactcactcaattcacgaataaatgccatattgcttttgctgcattagaagctgtttgtttccaaactcgagagattttggatgccatgaatcgagactgtggaattccactcagtcatttgcaggttgatggaggaatgaccagcaacaaaattcttatgcagctacaagcagacattctgtatattccagtagtgaagcccttgatgcccgaaaccactgcactgggtgctgccatggcggcaggggctgcagaaggagtcgacgtatggagtcttgaacctgaggatttgtccgccgtcacgatgaagcggtttgaacctcagattaatgctgaggaaagtgaaattcgttattctacatggaagaaagctgtgatgaagtcaatgggttgggttacaactcaatctccagaaggtggtgaccctagtgtcttctgtagtctgcccttgggcttttttatagtgagtagcatggcaatgttaatcggagcaaggtacatctcaggtattccataa
Sequence Length
1662
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,598 Da
NCBI Official Full Name
Homo sapiens glycerol kinase 3 pseudogene, mRNA
NCBI Official Synonym Full Names
glycerol kinase 3 pseudogene
NCBI Official Symbol
GK3P
NCBI Official Synonym Symbols
GKP3; GKTB
UniProt Protein Name
Putative glycerol kinase 3
UniProt Gene Name
GK3P
UniProt Synonym Gene Names
GKP3; GKTB; GK 3; Glycerokinase 3
UniProt Entry Name
GLPK3_HUMAN

Uniprot Description

Key enzyme in the regulation of glycerol uptake and metabolism.

Similar Products

Product Notes

The GK3P gk3p (Catalog #AAA1276033) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcct caaagaaggc agttttgggg ccattggtgg gggcagtgga ccaaggcacc agttccacgc gctttttggt tttcaattca agaacagctg aactacttag tcatcatcaa gtggaaataa aacaagagtt cccaagagaa ggatgggtgg aacaggaccc taaggaaatt ctacattctg tctatgagtg tatagagaaa acatgtgaga aacttggaca gctcaatatt ggtatttcca acataaaagc tattggtgtc agcaaccaga gggaaaccac cgtagtctgg gacaagataa ctggagagcc tctctacaat gctgtggtgt ggcttgatct aagaacacag tctaccgttg agagtcttag taaaagaatt ccaggaaata ataactttgt caagtccaag acaggccttc cacttagcac ttacttcagt gcagtgaaac ttcgctggct cctcgacaat gtgagaaaag ttcaaaaggc cgttgaagaa aaacgagctc tttttgggac tattgattca tggcttattt ggagtttgac aggaggcgtc aatggaggtg tccactgtac agatgtaaca aatgcaagta ggactatgct tttcaacatt cattctttgg aatgggataa acaactctgt gaattttttg gaattccaat ggaaattctt ccacatgttc ggagttcttc tgagatctat ggcctaatga aagcgggggc cttggaaggt gtgccaatat ctgggtgttt aggggaccag tctgctgcac tggtgggaca aatgtgcttc cagattggac aagccaaaaa tacgtatgga acaggatgtt tcttactatg taatacaggc cataagtgtg tattttctga tcatggcctt ctcaccacag tggcttacaa acttggcaga gacaaaccgg tatattacgc tttggaaggt tctgtagcta tagctggtgc tgttattcgc tggctaagag acaatcttgg aattataaag acctcagaag aaattgaaaa acttgctaaa gaagtaggta cttcttatgg ctgctacttc gtcccagcat tttcggggtt atatgcacct tattgggagc ccagcgcaag agggataatc tgtggactca ctcaattcac gaataaatgc catattgctt ttgctgcatt agaagctgtt tgtttccaaa ctcgagagat tttggatgcc atgaatcgag actgtggaat tccactcagt catttgcagg ttgatggagg aatgaccagc aacaaaattc ttatgcagct acaagcagac attctgtata ttccagtagt gaagcccttg atgcccgaaa ccactgcact gggtgctgcc atggcggcag gggctgcaga aggagtcgac gtatggagtc ttgaacctga ggatttgtcc gccgtcacga tgaagcggtt tgaacctcag attaatgctg aggaaagtga aattcgttat tctacatgga agaaagctgt gatgaagtca atgggttggg ttacaactca atctccagaa ggtggtgacc ctagtgtctt ctgtagtctg cccttgggct tttttatagt gagtagcatg gcaatgttaa tcggagcaag gtacatctca ggtattccat aa. It is sometimes possible for the material contained within the vial of "GK3P, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.