Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GIPC3 cdna clone

GIPC3 cDNA Clone

Gene Names
GIPC3; DFNB15; DFNB72; DFNB95; C19orf64
Synonyms
GIPC3; GIPC3 cDNA Clone; GIPC3 cdna clone
Ordering
For Research Use Only!
Sequence
atggagggagcagcggcccgggaggcccgggggaccgagaccccgcgcgcgtctgcgcccccgcccgcgccctcggagcccccggccgcgccccgcgcccgcccgcgcctcgtcttccgcacgcagctggcgcacgggagccccacgggcaagatcgagggcttcaccaacgtccgcgagctgtacgccaagatcgccgaagccttcgggatcgcgcccaccgagattttattctgcaccctcaacagccacaaagtggacatgcagaagctcctggggggtcagataggcctggaggacttcatctttgcccacgtgcgaggcgagaccaaggaggtggaggtcactaagacagaggatgctctggggctgaccatcacggacaacggggctggctacgccttcatcaagagaatcaaggaaggcagtatcatcaaccggatcgaggcagtgtgcgtgggtgacagcatcgaagccatcaacgaccactccattgtgggctgccgccactacgaggtggccaagatgctccgggagctgcccaagtcccagcccttcaccctgcgcctggtgcagcccaagagggccttcgatatgattggccagagaagtcggtccagcaaatgtccagtagaggcgaaagtgaccagcgggagggagaccctgcggcttcgttctgggggggctgccacagtggaggaagcgcccagtgagtttgaggaggaggcatctcggaaggttgatgacctgctggaaagctacatgggcattcgggaccccgagctggcgtccaccatggtggagacgtccaagaagacagcgagcgcccaggagtttgcacgctgtttagactccgtcttgggcgagttcgccttccccgacgagtttgtggtggaagtgtgggccgccatcggcgaggccagagaggcctgtggctag
Sequence Length
939
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,982 Da
NCBI Official Full Name
Homo sapiens GIPC PDZ domain containing family, member 3, mRNA
NCBI Official Synonym Full Names
GIPC PDZ domain containing family member 3
NCBI Official Symbol
GIPC3
NCBI Official Synonym Symbols
DFNB15; DFNB72; DFNB95; C19orf64
NCBI Protein Information
PDZ domain-containing protein GIPC3
UniProt Protein Name
PDZ domain-containing protein GIPC3
UniProt Gene Name
GIPC3
UniProt Synonym Gene Names
C19orf64
UniProt Entry Name
GIPC3_HUMAN

NCBI Description

The protein encoded by this gene belongs to the GIPC family. Studies in mice suggest that this gene is required for postnatal maturation of the hair bundle and long-term survival of hair cells and spiral ganglion in the ear. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2011]

Uniprot Description

GIPC3: Required for postnatal maturation of the hair bundle and long-term survival of hair cells and spiral ganglion. Defects in GIPC3 are the cause of deafness autosomal recessive type 15 (DFNB15). A form of non-syndromic sensorineural hearing loss with prelingual onset. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information. Belongs to the GIPC family.

Chromosomal Location of Human Ortholog: 19p13.3

Disease: Deafness, Autosomal Recessive 15

Research Articles on GIPC3

Similar Products

Product Notes

The GIPC3 gipc3 (Catalog #AAA1269382) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagggag cagcggcccg ggaggcccgg gggaccgaga ccccgcgcgc gtctgcgccc ccgcccgcgc cctcggagcc cccggccgcg ccccgcgccc gcccgcgcct cgtcttccgc acgcagctgg cgcacgggag ccccacgggc aagatcgagg gcttcaccaa cgtccgcgag ctgtacgcca agatcgccga agccttcggg atcgcgccca ccgagatttt attctgcacc ctcaacagcc acaaagtgga catgcagaag ctcctggggg gtcagatagg cctggaggac ttcatctttg cccacgtgcg aggcgagacc aaggaggtgg aggtcactaa gacagaggat gctctggggc tgaccatcac ggacaacggg gctggctacg ccttcatcaa gagaatcaag gaaggcagta tcatcaaccg gatcgaggca gtgtgcgtgg gtgacagcat cgaagccatc aacgaccact ccattgtggg ctgccgccac tacgaggtgg ccaagatgct ccgggagctg cccaagtccc agcccttcac cctgcgcctg gtgcagccca agagggcctt cgatatgatt ggccagagaa gtcggtccag caaatgtcca gtagaggcga aagtgaccag cgggagggag accctgcggc ttcgttctgg gggggctgcc acagtggagg aagcgcccag tgagtttgag gaggaggcat ctcggaaggt tgatgacctg ctggaaagct acatgggcat tcgggacccc gagctggcgt ccaccatggt ggagacgtcc aagaagacag cgagcgccca ggagtttgca cgctgtttag actccgtctt gggcgagttc gccttccccg acgagtttgt ggtggaagtg tgggccgcca tcggcgaggc cagagaggcc tgtggctag. It is sometimes possible for the material contained within the vial of "GIPC3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.