GIPC2 cdna clone
GIPC2 cDNA Clone
Gene Names
GIPC2; SEMCAP2; SEMCAP-2
Synonyms
GIPC2; GIPC2 cDNA Clone; GIPC2 cdna clone
Sequence
atgcccctgaagctgcgggggaagaagaaggccaagtccaaggagaccgccgggctggtggagggcgagccgacgggcgcgggcggcgggagcctctcagcgtcccgggctcccgcacgcaggctggtcttccacgcgcagctggcgcacggtagtgccacgggccgagtggagggcttctccagcatccaggagctctacgcccagatcgcgggcgcgtttgaaatctcgccgtcggagatcttatattgcactttaaacacacctaaaattgacatggaaagactcttaggaggacaactaggactagaagatttcatatttgcccatgtgaaaggaatcgaaaaagaagtgaatgtgtataaatctgaggattcacttggtctcaccattacagataatggtgttggctatgcttttataaagagaattaaagatggtggtgttattgactcagttaaaacaatctgtgttggggatcatattgaatccataaatggagaaaatattgttgggtggcgtcactatgatgttgctaagaagttaaaggaattaaaaaaggaggaactctttactatgaagttaatagaacctaagaaggcatttgaaatagagccgaggtcaaaggctggaaagtcatcaggagaaaaaattggttgtggaagggcaacacttcgcctgagatcaaaaggtcctgccaccgtggaagaaatgccttctgaaaccaaagcaaaggcaattgaaaagattgatgatgttcttgagttgtacatgggaattcgagatattgatttagccaccacaatgtttgaagctggaaaggacaaagtaaatccagatgaatttgctgtggcacttgacgaaactcttggagactttgcgttcccagacgaatttgtctttgatgtttggggagtcattggtgatgccaaacgaagaggattatga
Sequence Length
948
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
34,354 Da
NCBI Official Full Name
Homo sapiens GIPC PDZ domain containing family, member 2, mRNA
NCBI Official Synonym Full Names
GIPC PDZ domain containing family member 2
NCBI Official Symbol
GIPC2
NCBI Official Synonym Symbols
SEMCAP2; SEMCAP-2
NCBI Protein Information
PDZ domain-containing protein GIPC2
UniProt Protein Name
PDZ domain-containing protein GIPC2
Protein Family
UniProt Gene Name
GIPC2
UniProt Entry Name
GIPC2_HUMAN
Uniprot Description
GIPC2: Belongs to the GIPC family.
Chromosomal Location of Human Ortholog: 1p31.1
Molecular Function: protein binding
Research Articles on GIPC2
Similar Products
Product Notes
The GIPC2 gipc2 (Catalog #AAA1278932) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccctga agctgcgggg gaagaagaag gccaagtcca aggagaccgc cgggctggtg gagggcgagc cgacgggcgc gggcggcggg agcctctcag cgtcccgggc tcccgcacgc aggctggtct tccacgcgca gctggcgcac ggtagtgcca cgggccgagt ggagggcttc tccagcatcc aggagctcta cgcccagatc gcgggcgcgt ttgaaatctc gccgtcggag atcttatatt gcactttaaa cacacctaaa attgacatgg aaagactctt aggaggacaa ctaggactag aagatttcat atttgcccat gtgaaaggaa tcgaaaaaga agtgaatgtg tataaatctg aggattcact tggtctcacc attacagata atggtgttgg ctatgctttt ataaagagaa ttaaagatgg tggtgttatt gactcagtta aaacaatctg tgttggggat catattgaat ccataaatgg agaaaatatt gttgggtggc gtcactatga tgttgctaag aagttaaagg aattaaaaaa ggaggaactc tttactatga agttaataga acctaagaag gcatttgaaa tagagccgag gtcaaaggct ggaaagtcat caggagaaaa aattggttgt ggaagggcaa cacttcgcct gagatcaaaa ggtcctgcca ccgtggaaga aatgccttct gaaaccaaag caaaggcaat tgaaaagatt gatgatgttc ttgagttgta catgggaatt cgagatattg atttagccac cacaatgttt gaagctggaa aggacaaagt aaatccagat gaatttgctg tggcacttga cgaaactctt ggagactttg cgttcccaga cgaatttgtc tttgatgttt ggggagtcat tggtgatgcc aaacgaagag gattatga. It is sometimes possible for the material contained within the vial of "GIPC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
